8,430 results
-
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-K.l.LEU2
Plasmid#229229PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FLAG-APEX2-NES-TRP1
Plasmid#229228PurposeTemplate plasmid for the endogenous tagging with FLAG-APEX2-NAS in yeastDepositorTypeEmpty backboneExpressionYeastAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
PAF24
Plasmid#223172PurposeExpresses VC83_00191-yeGFP under control of CTR1 promoter and terminatorDepositorInsertCopper Transporter
TagsStreptagII and yeGFPExpressionYeastPromotersaccharomyces cerevisiae CTR1Available sinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 ymScarletI3
Plasmid#224106PurposeExpressing ymScarletI3 in yeastDepositorInsertymScarletI3
ExpressionYeastAvailable sinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-ymBaojin-URA3
Plasmid#224081PurposeYeast tagging vector to create a gene fusion with yeast optimized mBaojin with URA3 selectionDepositorInsertymBaoJin
TagsymBaoJinExpressionYeastAvailable sinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDRF1 ymBaojin
Plasmid#224085PurposeExpressing ymBaojin in yeastDepositorInsertymBaoJin
ExpressionYeastAvailable sinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only