We narrowed to 1,691 results for: CAG promoter
-
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralPromoterpCMV and U6Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBT272_(pRosa26-GTET)
Plasmid#36882DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
diphteria toxin A
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -EGFP
Plasmid#246994PurposeCan be used to generate AAV virus that will express EGFP from EF1α core promoterDepositorInsertEGFP
UseAAVPromoterEF1αAvailable SinceApril 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -NaChBac
Plasmid#246997PurposeCan be used to generate AAV virus that will express NaChBac from EF1α core promoterDepositorInsertNaChBac
UseAAVPromoterEF1αAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-A
Plasmid#85216PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-A
UseRetroviralExpressionMammalianPromoterH1Available SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-B
Plasmid#85217PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-B
UseRetroviralExpressionMammalianPromoterH1Available SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only