We narrowed to 2,343 results for: dcas9
-
Plasmid#121119PurposeEndogenous gene activation with the SunTag CRISPR activation systemDepositorInsertdCas9-GCN4x10_scFv-VP64
UseCRISPRExpressionMammalianPromoterTet-ONAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302_22aa_SunTag_MQ1(Q147L)_g4+g10+g18
Plasmid#172318PurposeCRISPR dCas9 SunTag system to target a variant of bacterial DNA methyltransferase MQ1 to install CG specific methylation to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_MQ1(Q147L)_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRi
Plasmid#199808Purposevector for constitutive CRISPRi-mediated gene knockdown in S. aureusDepositorInsertsdCas9
sgRNA with GFP cassette
UseCRISPRPromoterP23 and PRAB17 (sgRNA) and SarAP1 (GFP)Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPEPZ-sgRNAclone
Plasmid#141090PurposeThis vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.DepositorInsertmCherry
UseCRISPRExpressionBacterialPromoterp3Available SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
dCBE4-gam
Plasmid#124449PurposeExpresses dead Cas9 (dCas9)-CBE4-gamDepositorInsertdCBE4-gam
UseCRISPR and Synthetic BiologyExpressionMammalianMutationD10A, H840AAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBTK615
Plasmid#110609PurposeBTK assembled plasmid - used in Stage 2 assembly to target Cas9 or dCas9DepositorInsertsgRNA
UseSynthetic BiologyAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC0.017
Plasmid#119621PurposeLevel 0 Part. CDSDepositorInsertdCas9
UseSynthetic BiologyMutationbp 331 C to A , 1237 A to C, 1284 C to T, 2121 C …Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-1
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-2
Plasmid#109009PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC0.018
Plasmid#119622PurposeLevel 0 Part. CDSDepositorInsertdCas9+deg-tag
UseSynthetic BiologyMutationbp 331 C to A , 1237 A to C, 1284 C to T, 2121 C …Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJOG250
Plasmid#80582Purposerecipient plasmid [multiplexing, activator]; p35S:Cas9 D10A/N863A-Hax3CT, nptIIDepositorInsertspnos:nptII-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
BsaI-ccdB_CmR-BsaI
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJOG251
Plasmid#80583Purposerecipient plasmid [multiplexing, activator]; p35S:Cas9 D10A/N863A-Hax3CT, BASTADepositorInsertspnos:PAT-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
BsaI-ccdB_CmR-BsaI
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJOG252
Plasmid#80584Purposerecipient plasmid [single activator]; p35S:Cas9 D10A/N863A-Hax3CT, nptIIDepositorInsertspnos:nptII-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
pAtU6-BpiI-ccdB_CmR-BpiI_sgRNA_scaffold
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJOG253
Plasmid#80585Purposerecipient plasmid [single activator]; p35S:Cas9 D10A/N863A-Hax3CT, BASTADepositorInsertspnos:PAT-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
pAtU6-BpiI-ccdB_CmR-BpiI_sgRNA_scaffold
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-DNMT3a(R887E)-DNMT3l
Plasmid#154141PurposeExpresses a higher specificity variant of scFv-GCN4-DNMT3a-DNMT3l, contains R887E mutation in DNMT3a. To be used with the dCas9-SunTag system for targeted DNA methylation.DepositorInsertscFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
TagsHA and sfGFPExpressionMammalianMutationR887EPromoterSFFVAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA_MS2_neo
Plasmid#118650PurposeTo clone sgRNA for activation dCas9DepositorTypeEmpty backboneUseLentiviralPromoterU6Available SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only