We narrowed to 10,544 results for: yeast
-
Plasmid#232904PurposePlasmid carrying MSN5 from LY00045 (S288C) with its native promoter and terminator.DepositorInsertMSN5 (MSN5 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+Strep-Opa1 (SB254)
Plasmid#227603PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged Opa1 in Pichia pastorisDepositorInsertsTags10xHis and Twin-StrepTagExpressionYeastMutationcontains aa 253-960 onlyPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC25A46[∆2-83]-His (SB258)
Plasmid#227607PurposeInducible expression of His-tagged SLC25A46 lacking its N-terminal region (∆2-83) in Pichia pastorisDepositorInsertSLC25A46 (SLC25A46 Human)
Tags10xHisExpressionYeastMutationaa 2-83 deletedPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-Strep-Opa1(MGD) (SB252)
Plasmid#227601PurposeInducible expression of Strep-tagged Opa1(MGD) in Pichia pastorisDepositorInsertOPA1 (OPA1 Human)
TagsTwin-StrepTagExpressionYeastMutationcontains aa 253-580 (MGD) and aa 938-960PromoterAOX1Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-GAL4-PARP1-CAT-L713F
Plasmid#175949PurposeBacterial expression of a fusion of yeast GAL4 DNA binding domain and human PARP1 CAT domain containing L713F gain-of-function mutationDepositorInsertGAL4 DNA binding domain (GAL4 Budding Yeast)
Tags6xHis tagExpressionBacterialMutationL713F, V762A for the 'PARP1-CAT-L713F' …PromoterT7Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp21R
Plasmid#218287PurposeA complete plasmid for ToxAmp (Toxin-antitoxin-driven gene amplification) for the expression of AeBlueDepositorInsertHO(-955, -789)-LoxP>pKlLEU2>KlLEU2>PCRT1>RelB>tPDC1-pTDH3>AeBlue>tSYNth7-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only