We narrowed to 1,428 results for: aav vector plasmid
-
Plasmid#74513PurposeAAV vector that use human synapsin-1 promoter to drive the expression of EGFP and membrane-targeted EGFPf linked by self-cleaving P2A peptide.DepositorInsertEGFP-p2A-EGFP-f
UseAAVAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-2xmiR-1 target sites
Plasmid#120299PurposeAAV vector for expression of AcrIIA4 with two miR-1 binding sitesDepositorInsertAcrIIA4-2xmiR-1 binding sites
UseAAV and CRISPRTagsFLAGExpressionMammalianAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-ASAP3Kv-WPRE
Plasmid#132330Purposeexpresses ASAP3Kv(soma-located version of ASAP3, ASAP-family genetically encoded voltage indicator) in cre recombinase expressing mouse/cell, gene delivered by pAAV-EF1a vectorDepositorInsertASAP3KV
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceDec. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-ASAP3-WPRE
Plasmid#132318Purposeexpresses ASAP3(ASAP-family genetically encoded voltage indicator) in cre recombinase expressing mouse/cell, gene delivered by pAAV-EF1a vectorDepositorInsertASAP3
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceDec. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-L398T-WPRE-SV40
Plasmid#101064PurposeAAV vector expressing CaMPARI2_L398T (Kd = 825nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorHas ServiceAAV1InsertCaMPARI2_L398T
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-F391W-WPRE-SV40
Plasmid#101061PurposeAAV vector expressing CaMPARI2_F391W (Kd = 110nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorHas ServiceAAV1InsertCaMPARI2-F391W
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ100 AAV-SpABE8e-C_terminus-tracrRNA
Plasmid#211818PurposeAAV vector expressing C-terminus of SpCas9-ABE8e with tracrRNADepositorInsertC-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-H396K-WPRE-SV40
Plasmid#101062PurposeAAV vector expressing CaMPARI2_H396K (Kd = 360nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorInsertCaMPARI2-H396K
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(AAVS1)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#200502PurposeLentiviral vector expressing gRNA targeting human AAVS1DepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only