We narrowed to 5,257 results for: phy
-
Plasmid#224145PurposeIPTG-inducible expression of C. elegans protein MDH-1 with a chitin tagDepositorAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pBi2FC-N-MPK5-P2A:mCherry
Plasmid#216136PurposeControls for Bicistronic BiFCDepositorInsertMPK5 (MPK5 Mustard Weed)
ExpressionPlantAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD
Plasmid#216396PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1DepositorInsertEfg1-ΔDBD
Tags6xHis-tagsExpressionBacterialMutationdeleted amino acids 182-356Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-DBD
Plasmid#216399PurposeExpresses 6xHis-tagged DBD of Efg1DepositorInsertEfg1-DBD
Tags6xHis-tagsExpressionBacterialMutationdeleted amino acids 2-181 and 357-554Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xABRE_A
Plasmid#185803PurposeA synthetic ABA signaling reporter designed by multimerization of ABRE (7bp) and its flanking sequences from the ABI1 promoterDepositorInsert6xABRE(ABI1)+-86MP+erGFP
ExpressionPlantAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xABRE_R
Plasmid#185804Purposea synthetic ABA signaling reporter designed by multimerization of ABRE (7bp) and its flanking sequences from the RD29A promoterDepositorInsert6xABRE(RD29A)+-86MP+erGFP
ExpressionPlantAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ec-1 Triticum aestivum Metallothionein
Plasmid#200296PurposeBacterial expression plasmids for production of recombinant Triticum aestivum MetallothioneinDepositorInsertGene of metallothionein with Chiting Binding Domanin-Intein
TagsChiting Binding Domanin-InteinExpressionBacterialAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJet1.2-tHe-Tub1A2
Plasmid#201716PurposeTardigrade (Hypsibius exemplaris) alpha-tubulin Tub1A2DepositorInsertTub1A2
Available SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJet1.2-tHe-Tub1C1
Plasmid#201717PurposeTardigrade (Hypsibius exemplaris) alpha-tubulin Tub1C1DepositorInsertTub1C1
Available SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJet1.2-tHe-Tub2C
Plasmid#201722PurposeTardigrade (Hypsibius exemplaris) beta-tubulin Tub2CDepositorInsertTub2C
Available SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only