We narrowed to 19,341 results for: Comp
-
Plasmid#237618PurposePNLM-pcABE generated by pre-trained Protein-Nucleic Acid constrained Language Model exhibits high efficiency, a condensed editing window, and a shortened size.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPRExpressionMammalianMutationdeleted amino acids 2-8 and 147-152PromoterpCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-miniTurbo-NES-YFP
Plasmid#127369PurposeBinary vector for expressing cytosolic miniTurbo-YFP under the UBQ10 promoter in plantsDepositorInsertminiTurbo (BirA mutant)
TagsGS linker, NES, V5, and YFPExpressionPlantMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …PromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO GFP DNAJA2
Plasmid#19492DepositorAvailable SinceOct. 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
FP5369 KIF17MD-flag- FIREmate
Plasmid#216724PurposeExpresses motor domain of KIF17 fused to FIREmate in mamallian cellsDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_TFAM_mKate2
Plasmid#167331PurposeExpresses mKate2 fused to full length TFAM in mammalian cellsDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-Centrobin
Plasmid#136829PurposeMammalian expression of the centrosomal protein Centrombin N-terminally fused to SNAP-tagDepositorInsertSNAP-Centrobin (CNTROB Synthetic, Human)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
MYC-hTRAK2
Plasmid#225142PurposeExpresses MYC-tagged human TRAK2DepositorAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBABE-EGFP-THAP11-rescue-3xFLAG
Plasmid#37000DepositorInsertTHAP11 (THAP11 Human)
UseRetroviralTags3xFLAGExpressionMammalianMutationMutations were generated at codons 273-275 conver…Available SinceMay 21, 2012AvailabilityAcademic Institutions and Nonprofits only