We narrowed to 6,915 results for: tac
-
Plasmid#239708PurposePlasmid expressing mRuby2 with the EFS promoter and SV40 3' UTRDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG1972_pGEEC503_pShip-EFS-mRuby2-WPRE
Plasmid#239709PurposePlasmid expressing mRuby2 with the EFS promoter and WPRE 3' UTRDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG1973_pGEEC504_pShip-hPGK-mRuby2-bGH
Plasmid#239710PurposePlasmid expressing mRuby2 with the hPGK promoter and bGH 3' UTRDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG1974_pGEEC505_pShip-hPGK-mRuby2-SV40
Plasmid#239711PurposePlasmid expressing mRuby2 with the hPGK promoter and SV40 3' UTRDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG1975_pGEEC506_pShip-hPGK-mRuby2-WPRE
Plasmid#239712PurposePlasmid expressing mRuby2 with the hPGK promoter and WPRE 3' UTRDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG2021_pGEEC507_pShip-UbC-mRuby2-bGH
Plasmid#239713PurposePlasmid expressing mRuby2 with the UbC promoter and bGH 3' UTRDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG2022_pGEEC508_pShip-UbC-mRuby2-SV40
Plasmid#239714PurposePlasmid expressing mRuby2 with the UbC promoter and SV40 3' UTRDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG0586_pPV2-mRuby2
Plasmid#239695PurposeBsaI Golden Gate assembly plasmid encoding the mRuby2 CDSDepositorInsertmRuby2
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG1055_pPV2-tagBFP
Plasmid#239697PurposeBsaI Golden Gate assembly plasmid encoding the tagBFP CDSDepositorInserttagBFP
UseSynthetic BiologyMutationRemoval of BsaI cut sitesAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(h)-DEST-mKOk
Plasmid#224830PurposeEmpty Gateway DEST vector for expressing C-terminal tagged proteins with mKusabiraOrangekand hygromycin selection in plantsDepositorTypeEmpty backboneTagsmKusabiraOrangekExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.2
Plasmid#235461PurposeMessage phagemid carrying sgRNA2 (prom. J23119, backbone pBR322)DepositorInsertsgRNA2
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK302.2
Plasmid#235467PurposeMessage phagemid carrying sgRNA2 (prom. J23110, backbone pBR322)DepositorInsertsgRNA2
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
POSV801-SP44-SnaAinBCDEOT1T2
Plasmid#225056PurposeHeterologous expression in Streptomyces with inactive SnaADepositorInsertinactivated SnaA
ExpressionBacterialMutationS556A/S1616APromoterSP44Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
POSV801-SP44-SnaABCDEinOT1T2
Plasmid#225057PurposeHeterologous expression in Streptomyces with inactive SnaEDepositorInsertinactivated SnaE
ExpressionBacterialMutationdeltaA46-V801PromoterSP44Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAM198
Plasmid#227657PurposepRS305 His-HRV3C-Rpn5 WTDepositorAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM200
Plasmid#227659PurposepRS305 3XFLAG-HRV3C-Rpn5 WTDepositorAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pGGA016
Plasmid#228231PurposeLevel 0 for 5xOp (GreenGate A module)DepositorInsert5xOp
UseSynthetic BiologyAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGGC018
Plasmid#228232PurposeLevel 0 for LhG4 (GreenGate C module)DepositorInsertGR-LhG4
UseSynthetic BiologyPromoter-Available SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only