We narrowed to 170,489 results for: addgene
-
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLIK NPIPB11-FLAG zeo
Plasmid#192331PurposeLentiviral expression vector for an inducible NPIPB11-FLAGDepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT NPIPB11-FLAG
Plasmid#192308PurposeGateway entry vector for an inducible NPIPB11-FLAGDepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-NUP37
Plasmid#192299PurposeGateway entry vector for an inducible 3xFLAG-NUP37DepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-PFN2_variant2
Plasmid#192300PurposeGateway entry vector for an inducible 3xFLAG-PFN2_variant2DepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-tdTomato-sgRNA
Plasmid#194724Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA that target tdTomatoDepositorInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-cb5-pEGFP-C1
Plasmid#177431PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with its membrane binding region (MBR) replaced with Cb5 targeting sequence. Swap made in original Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationBik MBR removed (after position 136) and replaced…PromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-AA-pEGFP-C1
Plasmid#177430PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with 2 sites of phosphorylation mutated to alanine. T33A and S35A mutations made to Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationThreonine 33 and Serine 35 replaced with alaninePromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.004
Plasmid#184969PurposeNegative control, empty integrating inducible casetteDepositorTypeEmpty backboneExpressionYeastAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-T7TS-C312S
Plasmid#115263PurposeFor in vitro transcription of human NODAL open reading frame (with a mutated Cysteine residue) RNADepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-T7TS-N72A-N199A
Plasmid#115264PurposeFor in vitro transcription of human NODAL open reading frame (with two mutated N-glycosylation sites) RNADepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET15b/GVcl 1-1066 /*TBM
Plasmid#162781Purposeamplification of Gallus gallus Vcl mutated in Tankyrase Binding Domain IIDepositorArticleAvailable SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Nod-BFP2-TSERex
Plasmid#124785PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertNod-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v1)-PGK-Puro-BFP
Plasmid#117140PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v1 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMAZ.1.0-gDNA
Plasmid#112455PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MAZDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTHRB.1.0-gDNA
Plasmid#112429PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor THRBDepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
p240_LTJ_sgRNAFoxp3K276X
Plasmid#82675PurposesgRNA targeting murine Foxp3 mutant. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting Foxp3 K276X
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 26, 2018AvailabilityAcademic Institutions and Nonprofits only