We narrowed to 9,339 results for: UTY
-
Plasmid#185701PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(FCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(FCA)
UseTags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PDCA)-6xHis-NLS(SV40)
Plasmid#185705PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PDCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PDCA)
UseTags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(SCA)-6xHis-NLS(SV40)
Plasmid#185703PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(SCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(SCA)
UseTags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(PCA)-6xHis-NLS(SV40)
Plasmid#185704PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(PCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(PCA)
UseTags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-NLS(SV40)-anCas(BCA)-6xHis-NLS(SV40)
Plasmid#185702PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(BCA) with an N-terminal NLS and C-terminal NLSDepositorInsertanCas(BCA)
UseTags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_NLuc_FRT-PuroR
Plasmid#177865PurposeCloning Backbone for NanoLuc-luciferase-based EXSISERS containing FRT-sites flanked PuroR cassetteDepositorInsertNLuc-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsOLLASExpressionMammalianMutationPromoterAvailable sinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_BSD_FRT-PuroR
Plasmid#177867PurposeCloning Backbone for Blasticidin-S-deaminase-based EXSISERS containing FRT-sites flanked PuroR cassetteDepositorInsertBSD-based EXSISERS
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…TagsOLLASExpressionMammalianMutationPromoterAvailable sinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_SurfaceHaloTag_FRT-PuroR
Plasmid#177869PurposeCloning Backbone for Surface-HaloTag-based EXSISERS containing FRT-sites flanked PuroR cassette; clone homology arms via BbsI (or BpiI).DepositorInsertSurface-HaloTag-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsExpressionMammalianMutationPromoterAvailable sinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Cstem-Tac(5A)
Plasmid#162497PurposeExpresses GFP tagged Tac mutant in mammalian cells. The five O-glycosylation sites in the stem region are mutated, and the stem region of CD8a is inserted between GFP and Tac(5A).DepositorUseTagsGFPExpressionMammalianMutationThe five threonine residues are mutated into alan…PromoterAvailable sinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 rtTA BirA eIF4G +MIC
Plasmid#158790PurposepcDNA5 based transfection plasmid for the exogenous expression of N-terminal BirA-Flag-tagged eIF4G1 including the microexon for generation of N2A FlpIn cell lines for BioIDDepositorInserteIF4G1 (with microexon)
UseTags3xFlag and BirA*ExpressionMammalianMutationPromoterminiCMVAvailable sinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9ExpressionMutationPromoterU6 and CBhAvailable sinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS1132
Plasmid#29053PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP/Cre fusion reporterDepositorInsertPle67 (FEV Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSExpressionMutationPromoterAvailable sinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-mVenus-P2A-NRASG12V
Plasmid#236072PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12VPromoterCAGGSAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/UBC-mVenus-P2A-NRASG12V
Plasmid#236074PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Ubc promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12VPromoterUbcAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-NRASG12V/D38A-IRES-mVenus
Plasmid#236077PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and a double mutant NRAS (NRASG12VD38A).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12V D38APromoterCAGGSAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-NRASG12V-IRES-mVenus
Plasmid#236076PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12VPromoterCAGGSAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/PGK-mVenus-P2A-NRASG12V
Plasmid#236073PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Pgk promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidTagsExpressionMutationG12VPromoterPGKAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Gq-CASE
Plasmid#168125PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gq. Composed of the subunits G alpha q (GNAQ) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagscpVenus on GNG9ExpressionMammalianMutationNLuc is inserted at F124/E125 within GNAQPromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
G15-CASE
Plasmid#168126PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein G15. Composed of the subunits G alpha 15 (GNA15) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagscpVenus on GNG9ExpressionMammalianMutationNLuc is inserted at E244/N245 within GNA15PromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gi2-CASE
Plasmid#168121PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi2. Composed of the subunits G alpha i2 (GNAI2) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at C112/E115 within GNAI2PromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
G13-CASE
Plasmid#168127PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein G13. Composed of the subunits G alpha 13 (GNA13) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagscpVenus on GNG9ExpressionMammalianMutationNLuc is inserted at F125/D126 within GNA13PromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gi1-CASE
Plasmid#168120PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi1. Composed of the subunits G alpha i1 (GNAI1) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at A121/E122 within GNAI1PromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gi3-CASE
Plasmid#168122PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi3. Composed of the subunits G alpha i3 (GNAI3) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at A114/E115 within GNAI1PromoterAvailable sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_mGreenLantern_FRT-PuroR-HSV-TK
Plasmid#177868PurposeCloning Backbone for mGreenLantern-based EXSISERS containing FRT-sites flanked PuroR-HSV-TK cassette; clone homology arms via BbsI (or BpiI).DepositorInsertmGreenLantern-based EXSISERS
UseCRISPR, Synthetic Biology, and UnspecifiedTagsOLLASExpressionMammalianMutationPromoterAvailable sinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPRoff-mScarletI
Plasmid#217783PurposeExpresses CRISPRoff-mScarletI (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-mScarletI-KRAB) downstream of the CAG promoter for gene epigenetic silencingDepositorInsertCRISPRoff-mScarletI (DNMT3A-DNMT3L-dCas9-mScarletI-KRAB)
UseTags2xNLS, DNMT3A-DNMT3L, HA, KRAB, and mScarletIExpressionMammalianMutationPromoterCAGAvailable sinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFC34K LgBiT TK-Neo Human collagen type IV alpha 5 chain (COL4A5)
Plasmid#229770PurposeHuman Col4A5 tagged at C-terminal with LgBiT to be used with C-tagged SmBiT hCol4A3 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorInsertHuman collagen type IV alpha 5 chain (COL4A5) (COL4A5 Human)
UseLuciferaseTagsLgBiTExpressionMutationPromoterAvailable sinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFC36K SmBiT TK-neo Human collagen type IV alpha 3 chain (COL4A3)
Plasmid#229769PurposeHuman Col4A3 tagged at C-terminal with SmBiT to be used with C-tagged LgBiT hCol4A5 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorInsertHuman collagen type IV alpha 3 chain (COL4A3) (COL4A3 Human)
UseLuciferaseTagsSmBiTExpressionMutationPromoterAvailable sinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFN33K LgBiT TK-neo Human collagen type IV alpha 5 chain (COL4A5)
Plasmid#229768PurposeHuman Col4A5 tagged at N-terminal with LgBiT to be used with N-tagged SmBiT hCol4A3 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorInsertHuman collagen type IV alpha 5 chain (COL4A5) (COL4A5 Human)
UseLuciferaseTagsLgBiTExpressionMutationPromoterAvailable sinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFN35K SmBiT TK-neo Human collagen type IV alpha 3 chain (COL4A3)
Plasmid#229767PurposeHuman Col4A3 tagged at N-terminal with SmBiT to be used with N-tagged LgBiT hCol4A5 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorInsertHuman collagen type IV alpha 3 chain (COL4A3) (COL4A3 Human)
UseLuciferaseTagsSmBiTExpressionMutationSee Depositor CommentsPromoterAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX401-INK4A
Plasmid#121919PurposeDoxycycline-inducible expression of p16-INK4A product of CDKN2ADepositorInsertp16-INK4A (CDKN2A Human)
UseLentiviralTagsExpressionMammalianMutationPromoterTRE Tet ONAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-A
Plasmid#200824PurposeAAV transfer plasmid encoding a circularized RNA barcode A under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianMutationPromoterhSynAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 human PP2A Aα full length
Plasmid#132634Purposeexpresses human PP2A Aα full length in E. coliDepositorInsertPP2A Aα (PPP2R1A Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFUW-VenusFlag-hCD44
Plasmid#211824PurposeExpress CD44 in mammalian cellsDepositorInsertCD44 (CD44 Human)
UseLentiviralTagsN-Terminal Venus and Flag tagsExpressionMammalianMutationisoform corresponds to UniProt ID P16070-1 with a…PromoterAvailable sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_hACE2_HygR
Plasmid#155296PurposeLentiviral vector to generate hACE2 stable expressing cell line, Hygromycin resistanceDepositorInserthACE2 (ACE2 Human)
UseLentiviralTagsC9ExpressionMutationPromoterCMVAvailable sinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGEX-4T1 human PP2A B56α full length
Plasmid#132635Purposeexpresses human PP2A B56α full length in E. coliDepositorInsertPP2A B56α
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDRM55 tet-AR(1-707)
Plasmid#183503PurposeLentiviral vector expressing a doxycycline-inducible constitutively active truncated androgen receptor (wild type AR)DepositorInsertAndrogen receptor (AR Human)
UseLentiviralTagsExpressionMammalianMutationConstitutively active truncated AR; spans AR 1-70…PromoterCMVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-mgp100-PuroR [M1G]
Plasmid#171802PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, murine gp100 CD8+ T cell epitope [AA: 25-33 (EGSRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-mgp100-T2A-PuroR
UseGene taggingTagsExpressionMutationPuroR: Changed Methionin 1 to Glycine.PromoterAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEx-iSeroSnFR-EnhancedExport
Plasmid#129180PurposeFluorescent reporter for serotonin imaging (conditional + membrane localization tag with enhanced export sequence)DepositorInsertiSeroSnFR
UseAAVTagsIg-kappa leader, Myc, and PDGFR + enhanced ER exp…ExpressionMutationPromoterCAGAvailable sinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHis6-SUMO-g0s2
Plasmid#179293PurposeE. coli expression plasmid (T7 promoter) for full-length human G0S2 with N-terminal His6 + SUMO + TEV protease cleavage siteDepositorInsertG0S2 (G0S2 Human)
UseTagsHis6 + SUMO + TEV protease cleavage siteExpressionBacterialMutationfull-length G0S2, residues 1-103 from accession n…PromoterT7Available sinceFeb. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS2 (CK2alpha', CK2beta)
Plasmid#27093DepositorUseTetracycline-regulated expressionTagsHA and MycExpressionMammalianMutationPromoterbidirectional tet-responsive promoterAvailable sinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
JDW 742 (pDONR221-EGFP-KRAS4B-G12V)
Plasmid#156403PurposeGateway middle entry clone encoding EGFP-fused to human KRAS4B with G12V mutation, includes a stop codonDepositorInserthuman mutant KRAS4B-G12V (KRAS Human)
UseGateway cloningTagsEGFPExpressionMutationmutant KRAS4B-G12VPromoterAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGV13 (CK2alpha K68M, CK2beta)
Plasmid#27094DepositorUseTetracycline-regulated expressionTagsHA on CK2alpha and Myc on CK2betaExpressionMammalianMutationK68M on CK2alphaPromoterbidirectional tet-responsive promoter and bidirec…Available sinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
JDW 837 (pCS2-V5-mScarlet-I-hsKRAS4A-G12V)
Plasmid#156410PurposepCS2 CMV expression vector driving V5-tagged mScarlet-I-fused human KRAS4A-G12VDepositorInserthuman mutant KRAS4A-G12V (KRAS Human)
UseTagsmScarlet-IExpressionMammalianMutationmutant KRAS4A-G12VPromoterCMVAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
JDW 827 (pCS2-V5-mTagBFP2-hsKRAS4A-G12D)
Plasmid#156409PurposepCS2 CMV expression vector driving V5-tagged mTagBFP2 fused human KRAS4A-G12DDepositorInserthuman mutant KRAS4A-G12D (KRAS Human)
UseTagsmTagBFP2ExpressionMammalianMutationmutant KRAS4A-G12DPromoterCMVAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
JDW 762 (pCS2-EGFP-hsKRAS4B-G12V)
Plasmid#156407PurposepCS2 CMV expression vector driving EGFP fused human KRAS4B-G12VDepositorInserthuman mutant KRAS4B-G12V (KRAS Human)
UseTagsEGFPExpressionMammalianMutationmutant KRAS4B-G12VPromoterCMVAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
JDW 829 (pTol2-kdrl:V5-mTagBFP2-hsKRAS4A-G12D-ac/Y)
Plasmid#156415Purposekdrl promoter driving V5-tagged mTagBFP2 fused to human KRAS4A-G12D with an alpha-crystallin Venus (YFP) reporter flanked by Tol2 sitesDepositorInserthuman mutant KRAS4A-G12D (KRAS Human)
UseZebrafish transgenesisTagsmTagBFP2ExpressionMutationmutant KRAS4A-G12DPromoterkdrlAvailable sinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-B
Plasmid#200825PurposeAAV transfer plasmid encoding a circularized RNA barcode B under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianMutationPromoterhSynAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-C
Plasmid#200826PurposeAAV transfer plasmid encoding a circularized RNA barcode C under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianMutationPromoterhSynAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-racRNA-D
Plasmid#200827PurposeAAV transfer plasmid encoding a circularized RNA barcode D under U6 promoter and a subcellular localization protein binder under hSyn promoterDepositorInsertsU6-racRNA
V5-PP7cp-M9-NES-T2A-Flag-PP7cp-Far
UseAAVTagsC-Far, Flag, and V5ExpressionMammalianMutationPromoterhSynAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only