We narrowed to 6,876 results for: mag
-
Plasmid#207606PurposesgRNA for the insert of the HaloTag at the endogenous loci of XRCC4.DepositorInsertTACTGGGTTCAGAAACAAGG
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAD-luxNeon
Plasmid#229942PurposeBacterial expression of a de novo designed, FRET-based neoLux1.2-mNeonGreen fusion bioluminescent probe (max. Em=518nm)DepositorInsertluxNeon
TagsHis-tagExpressionBacterialPromoteraraBADAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28b-TREER
Plasmid#208321PurposeBacterial expression of the His-tagged peptide TREER.DepositorInsertTREER
TagsDBCO-Tag, His-TagExpressionBacterialAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA TfR1-PuRRRE
Plasmid#208327PurposeC-terminal PuRRRE-tagged transferrin receptor 1 (tag on extracellular domain).DepositorInsertTfR1-PuRRRE
TagsPuRRREExpressionMammalianAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA TfR1-TREER
Plasmid#208325PurposeC-terminal TREER-tagged transferrin receptor 1 (tag on extracellular domain).DepositorInsertTfR1-TREER
TagsTREERExpressionMammalianAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28b-PuRRRE
Plasmid#208323PurposeBacterial expression of the His-tagged peptide PuRRRE.DepositorInsertPuRRRE
TagsDBCO-Tag, His-TagExpressionBacterialAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFH2.156_LV-Zeo
Plasmid#205554PurposeExpress zeocin resistance markerDepositorInsertZeo
UseLentiviralExpressionMammalianMutationWTPromoterEF1Available SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
XLone-mARG2
Plasmid#173792PurposeMammalian acoustic reporter gene 1 cassette 2 on XLone plasmidDepositorInsertGvpN, F G L S K J U
TagsGFPExpressionMammalianPromoterTRE3G promoterAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
JAB2488
Plasmid#190373PurposePlasmids encode parts for syntetic genetic circuit construction in eudicot plants (proG1090::IcaR-NLS_19St)DepositorInsertproG1090::IcaR-NLS_19St
ExpressionPlantAvailable SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only