We narrowed to 1,496 results for: asl;

#154019

Vector based on the LiOn integration-coupled translational switch and devoid of TTAA sequences, expressing the fluorescent protein mRFP1 from a CAG promoter upon action of the piggyBac transposase

Jean Livet

Kumamoto et al Neuron. 2020 Aug 19;107(4):617-630.e6. d

Aug. 10, 2020

Academic Institutions and Nonprofits only

#235712

Expression of FL human VPS34-EGFP in mammalian cells

Roger Williams

Tremel et al Nat Commun. 2021 Mar 10;12(1):1564. doi:

May 13, 2025

Academic Institutions and Nonprofits only

#154018

Vector based on the LiOn integration-coupled translational switch (Kumamoto et al bioRxiv 2019) expressing a functional Cre recombinase from a CMV promoter upon action of the piggyBac transposase

Jean Livet

Kumamoto et al Neuron. 2020 Aug 19;107(4):617-630.e6. d

Aug. 10, 2020

Academic Institutions and Nonprofits only

#154016

Vector based on the LiOn integration-coupled translational switch (Kumamoto et al bioRxiv 2019) expressing the fluorescent protein mRFP1 from a CAG promoter upon action of the piggyBac transposase

Jean Livet

Kumamoto et al Neuron. 2020 Aug 19;107(4):617-630.e6. d

Sept. 29, 2020

Academic Institutions and Nonprofits only

#117660

Test intracellular localisation of E2-Crimson and study the secretion efficiency

Pau Ferrer, Benjamin Glick

Barrero et al Microb Cell Fact. 2018 Oct 12;17(1):161.

Dec. 12, 2018

Academic Institutions and Nonprofits only

#105729

Mammalian expression of mutant human alpha synuclein

Hilal Lashuel

Mbefo et al J Biol Chem. 2015 Apr 10;290(15):9412-27

March 29, 2018

Academic Institutions and Nonprofits only

#87391

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87407

p425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87404

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87386

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only