We narrowed to 2,515 results for: gcg
-
Plasmid#77734Purpose3rd generation lentiviral gRNA plasmid targeting human ABL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
TET-pLKO.1 PURO shGDF11 #1
Plasmid#83083PurposeLentiviral shRNA vector for inducible knockdown of human GDF11 (cross reacts with mouse Gdf11)DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
CSNK1E gRNA (BRDN0001147318)
Plasmid#77977Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1EDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_1k)-PGKpuro2ABFP-W
Plasmid#208410PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_2m)-PGKpuro2ABFP-W
Plasmid#208411PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
KHC065 pBABE pU6 BRD2 K1-2C
Plasmid#231712PurposeKHC065 (pBABE pU6 BRD2 K1-2C), gRNA and cas9D10A mammalian expression vector for CRISPR mediated cutting of BRD2 at the N-terminus, use with KHC064DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
KHC064 pX335 BRD2 K1-1a
Plasmid#231711PurposeKHC064 (pX335 BRD2 K1-1a), gRNA and cas9D10A mammalian expression vector for CRISPR mediated cutting of BRD2 at the N-terminus, use with KHC065DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-ngRNA+15_EF1a-puroR
Plasmid#207360PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of L227R-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR +15 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETV4_5-1)-PGKpuroBFP-W
Plasmid#211960PurposeExpress gRNA against ETV4 with puro and BFPDepositorInsertsgRNA targeting ETV4 (ETV4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BCL11B-E4(44))-PGKpuro2ABFP-W
Plasmid#208560PurposeLentiviral vector expressing gRNA targeting human BCL11B-E4DepositorInsertBCL11B-E4(44) (BCL11B Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BCL11B-E2(24))-PGKpuro2ABFP-W
Plasmid#208555PurposeLentiviral vector expressing gRNA targeting human BCL11B-E2DepositorInsertBCL11B-E2(24) (BCL11B Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(RUNX1(13))-hU6gRNA5(RUNX3(13))-PGKpuroBFP-W
Plasmid#208570PurposeLentiviral vector expressing gRNA targeting human RUNX1 and RUNX3DepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-3'UTR mouse Il13 mutDRACH
Plasmid#207130PurposeLuciferase vector containing 3'UTR for mouse Il13 with mutated DRACH sitesDepositorInsertInterleukin 13 (Il13) 3'UTR (Il13 Mouse)
UseLuciferaseExpressionMammalianMutationTGAGGAGAGACCATCCCTGGGCATCTCAGCTGTGGACTCATTTTCCTTT…Available SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD 3R-3E
Plasmid#188148PurposeExpresses C-terminal flag-tagged human CAD 3R-3E in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX335_U6-Chimeric_BB-CBh-hSpCas9n(D10A)_SOX17_Ex2_KI
Plasmid#195502PurposeCas9 nickase expression vector bearing a sgRNA targeting Exon 2 of human SOX17DepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only