We narrowed to 1,496 results for: asl;

#87405

p426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#208095

Perturb-Seq lentiviral gRNA expression vector with a 3' appended capture sequence to enable direct capture of CRISPR gRNAs for scRNA-seq

John Doench

Geiger-Schuller et al bioRxiv. 2023 Jan 24:2023.01.23.525198.

Sept. 14, 2023

Academic Institutions and Nonprofits only

#87409

p426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#235741

Expression of VPS34 (REIE to AAAA)_FL - EGFP in mammalian cells

Roger Williams

Tremel et al Nat Commun. 2021 Mar 10;12(1):1564. doi:

May 14, 2025

Academic Institutions and Nonprofits only

#87408

p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#240098

human PAX3::FOXO1 in -2A-sfGFP backbone (Plasmid# 74668)

Genevieve Kendall

Kucinski et al Cell Rep. 2025 Jul 22;44(7):115923. doi:

Oct. 14, 2025

Academic Institutions and Nonprofits only

#125922

Targeting expression to neuronal and glial cell types in mice, non-human primates, and human retina

Botond Roska

Juttner et al Nat Neurosci. 2019 Jul 8. pii: 10.1038/s

Sept. 19, 2019

Academic Institutions and Nonprofits only

#195282

Bicistronic DTR and Puromycin resistance for positive/negative selection

Scott Lowe

Barriga et al Nat Cancer. 2022 Nov;3(11):1367-1385. do

Jan. 26, 2023

Academic Institutions and Nonprofits only

#195283

Bicistronic DTR and Hygromycin resistance for positive/negative selection

Scott Lowe

Barriga et al Nat Cancer. 2022 Nov;3(11):1367-1385. do

Jan. 26, 2023

Academic Institutions and Nonprofits only

#125937

Targeting expression to neuronal and glial cell types in mice, non-human primates, and human retina

Botond Roska

Juttner et al Nat Neurosci. 2019 Jul 8. pii: 10.1038/s

Sept. 20, 2019

Academic Institutions and Nonprofits only