We narrowed to 10,490 results for: nar;
-
Plasmid#211783PurposeSunTag counterpart binding domain, aGCN4, fused to DNA methyltransferase DNMT3A, with GFP selectionDepositorInsertaGCN4-DNMT3A
UseTags3xTy1ExpressionMammalianMutationLast 300 bp codon optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available sinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMA7
Plasmid#79967PurposeTM-MAGE strainDepositorInsertsLambda Red recombinase beta subunit
DNA adenine methylase
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterpBADAvailable sinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 RDF ( GB1498)
Plasmid#160579PurposeStreptomyces phage PhiC31-encoded recombination directionality factor (RDF) (PhiC31 gp3)DepositorInsertRDF
UseSynthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
PHY98-LMNA 5'HA-TriTag (mTagBFP)-3'HA (HDR donor)
Plasmid#164046PurposeCRISPR donor plasmid to insert TriTag (mTagBFP) into the N-terminus of human LMNA geneDepositorInsertmTagBFG-TriTag
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT-9208
Plasmid#124221PurposeCloning plasmid for a self-targeting gRNA libraryDepositorInsertself-targeting gRNA
UseCRISPRTagsExpressionBacterialMutationPromoterJ23119Available sinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 integrase (GB1496)
Plasmid#160578PurposeStreptomyces phage PhiC31 integrase, complete CDSDepositorInsertPhiC31
UseSynthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
LC501: pMVP (L3-L2) mCherry + polyA
Plasmid#121765PurposepMVP L3-L2 entry plasmid, contains mCherry + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term mCherry fusion to gene of interest.DepositorInsertmCherry + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JP705: pMVP/SB/Neo-DEST
Plasmid#121866PurposepMVP destination vector, empty Sleeping Beauty transposon vector backbone w/ Neo selection cassetteDepositorTypeEmpty backboneUseSleeping beauty transposon, pmvp gateway destinat…TagsExpressionMammalianMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFBP-4_1.sensor
Plasmid#162844PurposeYeast expression of the RNA-based sensor for fructose-1,6-bisphosphate #4_1DepositorInsert4_1_RNA-device
UseTagsExpressionYeastMutationPromoterAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFBP-4_1m.mutant
Plasmid#162869PurposeYeast expression of the mutant #4_1m for the RNA-based sensor of fructose-1,6-bisphosphate #4_1DepositorInsert4_1m_RNA-device
UseTagsExpressionYeastMutationPromoterAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 alpha1 Pnos:PhiC31int:Tnos (GB1531)
Plasmid#160616PurposeTU for the constitutive expression of Streptomyces phage PhiC31 integrase.DepositorInsertPhiC31
UseSynthetic BiologyTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
KP201: pMVP (L5-L4) eGFP-P2A
Plasmid#121708PurposepMVP L5-L4 entry plasmid, contains eGFP-P2A for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term eGFP linked by P2A to gene of interest.DepositorInserteGFP-P2A (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KP301: pMVP (L5-L4) mCherry-P2A
Plasmid#121710PurposepMVP L5-L4 entry plasmid, contains mCherry-P2A for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term mCherry linked by P2A to gene of interest.DepositorInsertmCherry-P2A (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP2-F404AF407AF409A_V
Plasmid#147813PurposeMammalian Expression of HsDCP2-F404AF407AF409ADepositorInsertHsDCP2-F404AF407AF409A (DCP2 Human)
UseTagsExpressionMammalianMutationtwo silent mutations compared to the sequence giv…PromoterAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐Afu‐rnhBΔPIP
Plasmid#108696PurposeFor expression in E. coli, and affinity purification of N-terminally GST-tagged Archaeoglobus fulgidus RNase HII with C-terminal PIP box deletionDepositorInsertrnhB
UseTagsGSTExpressionBacterialMutationC-terminal truncation (7aa) removing PIP boxPromotertacAvailable sinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
KZ001: pMVP (L3-L2) P2A-eYFP + polyA
Plasmid#121770PurposepMVP L3-L2 entry plasmid, contains eYFP-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eYFP linked by P2A to gene of interest.DepositorInsertP2A-eYFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KP501: pMVP (L5-L4) eYFP-P2A
Plasmid#121714PurposepMVP L5-L4 entry plasmid, contains eYFP-P2A for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term eYFP linked by P2A to gene of interest.DepositorInserteYFP-P2A (open)
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LacI/109-pHG165c
Plasmid#90058PurposeWT LacI polymorphism with T at position 109DepositorInsertLacI/109
UseTagsExpressionBacterialMutation109PromoterIqAvailable sinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only