We narrowed to 6,677 results for: &alpha
-
Plasmid#77418Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PIK3CA gRNA (BRDN0001145530)
Plasmid#77416Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KB1 gRNA (BRDN0001145729)
Plasmid#75612Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KB1 gRNA (BRDN0001145927)
Plasmid#75613Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KB1 gRNA (BRDN0001148368)
Plasmid#75614Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3CA gRNA (BRDN0001146960)
Plasmid#77415Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWzl_neo_DEST_flag_PIK3CA
Plasmid#45308DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pScalps_puro_mIL-2Rα RK
Plasmid#59920PurposeExpresses mouse interleukin-2 receptor alpha chain mutatedDepositorInsertinterleukin 2 receptor alpha (Il2ra Mouse)
UseLentiviralMutationchanged sequence of the intracellular (C-terminal…Available SinceOct. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
PIK3CA gRNA (BRDN0001146906)
Plasmid#77417Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRubiG-T2A-AKT1-T2A-Cre
Plasmid#189011PurposeRetroviral vector with a ubiquitin promoter expressing GFP, human AKT1 ORF, and Cre recombinase, separated by T2A motifs.DepositorInsertAKT1 (AKT1 Human)
UseRetroviralAvailable SinceMarch 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB414_35S-(ΔTP)DM3(Col-0)-HA
Plasmid#229725PurposeStable transformation or transient expression of gene of interest in plantsDepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB414_35S-(ΔTP)DM3(Hh-0)-HA
Plasmid#229724PurposeStable transformation or transient expression of gene of interest in plantsDepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Col-0)
Plasmid#229714PurposeStable transformation or transient expression of gene of interest in plantsDepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Hh-0)
Plasmid#229713PurposeStable transformation or transient expression of gene of interest in plantsDepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB414_35S-DM3(Col-0)-HA
Plasmid#229712PurposeStable transformation or transient expression of gene of interest in plantsDepositorInsertDM3(Col-0) (AT3G61540 Mustard Weed)
ExpressionPlantAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB414_35S-DM3(Hh-0)-HA
Plasmid#229711PurposeStable transformation or transient expression of gene of interest in plantsDepositorInsertDM3(Hh-0) (AT3G61540 Mustard Weed)
ExpressionPlantAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Col-0) T165I
Plasmid#229726PurposeStable transformation or transient expression of gene of interest in plantsDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET28 His-SUMO-CHMP2B
Plasmid#232018PurposeBacterial expression of His and SUMO tagged CHMP2BDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB515_35S-HA-(ΔTP)DM3(Col-0) Q345R
Plasmid#229720PurposeStable transformation or transient expression of gene of interest in plantsDepositorInsertDM3(Col-0) (AT3G61540 Mustard Weed)
ExpressionPlantMutationamino acid 1-52 were deleted, Q345RAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only