We narrowed to 15,623 results for: grna
-
Plasmid#102898PurposeEBNA episome plasmid for U6 promoter-driven expression of 5 gRNAs targeting EEA-motif. Includes PGK-puro selection cassette.DepositorInsertEEA-5guides-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2516
Plasmid#91084PurposeModule C, Promoter: At7SL, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterAt7SLAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJin-264
Plasmid#125717PurposeABA-inducible split T7 gRNA for GFP vector using RNAPN d5-19DepositorInsertPT7-gRNA GFP expression, PYL-linker-T7 RNAPC, T7 RNAPN (d5-19)-linker-ABI
ExpressionMammalianAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CHyMErA_U6(SpCas9_I-SceI)-(AsCas12_PacI)_PGK-puro
Plasmid#189634PurposeLentiviral expression of single SpCas9 and AsCas12a gRNAs for generating combinatorial CHyMErA 3Cs librariesDepositorInserthU6 Cas9-Cas12a gRNA cassette, PGK puro cassette
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFH49
Plasmid#128211Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCAS9 wt (BB)-2A-GFP targeting human TRIM21
Plasmid#138295PurposegRNA for CRISPR/Cas9 knockout of human TRIM21DepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT60
Plasmid#223432PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by 2x35s and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsert2x35s-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT15
Plasmid#223387PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by 2x35s and the sgRNA was driven by AtU3 promoter.DepositorInsert2x35s-hA3A-Y130F-SpCas9-D10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT17
Plasmid#223389PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpCas9-D10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
THI VP64 pGAP T-
Plasmid#161487PurposeNon targeting control for CRISPR/RNA scaffold based transcription regulation in Pichia pastoris BB3rN_pTEF2_dCAS9(3xFLAG_SV40NLS)_pPOR1_MS2bind_VP64_SV40NLS_pGAP_THI11_T-_gRNA_MS2DepositorInsertsdCAS9
MS2-VP64
gRNA (Non targeting control NTC)
ExpressionYeastPromoterpGAP, pPOR1, and pTEF2Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
THI VP64 pGAP T1
Plasmid#161488PurposeCRISPR/RNA scaffold based transcription regulation in Pichia pastoris BB3rN_pTEF2_dCAS9(3xFLAG_SV40NLS)_pPOR1_MS2bind_VP64_SV40NLS_pGAP_THI11_T1_gRNA_MS2DepositorInsertsdCAS9
MS2-VP64
gRNA (Targeting T1 in the THI11 promoter)
ExpressionYeastPromoterpGAP, pPOR1, and pTEF2Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
THI VP64 pGAP T5
Plasmid#161492PurposeCRISPR/RNA scaffold based transcription regulation in Pichia pastoris BB3rN_pTEF2_dCAS9(3xFLAG_SV40NLS)_pPOR1_MS2bind_VP64_SV40NLS_pGAP_THI11_T5_gRNA_MS2DepositorInsertsdCAS9
MS2-VP64
gRNA (Targeting T5 in the THI11 promoter)
ExpressionYeastPromoterpGAP, pPOR1, and pTEF2Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
RIB VP64 R1
Plasmid#161493PurposeCRISPR/RNA scaffold based transcription regulation in Pichia pastoris BB3rN_pTEF2_dCAS9(3xFLAG_SV40NLS)_pPOR1_MS2bind_VP64_SV40NLS_pGAP_RIB1_R1_gRNA_MS2DepositorInsertsdCAS9
MS2-VP64
gRNA (Targeting R1 in the RIB1 promoter)
ExpressionYeastPromoterpGAP, pPOR1, and pTEF2Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHBS953 TARDBP-Exon2-ko-sgRNA2-SpCas9
Plasmid#107858PurposeTo knock-out TDP43DepositorInsertgRNA against TARDBP (Exon 2) (TARDBP Human)
ExpressionMammalianAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
gRNA giantin/GOLGB1
Plasmid#222315PurposeCRISPR/Cas9 close to the ATG of giantin/GOLGB1 gene.DepositorInsertgRNA targeting GOLB1 (GOLGB1 Human)
UseCRISPRAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCJ1023
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterhuman U6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE3-gRNA#3
Plasmid#107731PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAGK62
Plasmid#228122PurposeExpress node 1531 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 1531 split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA_Cloning Vector BbsI
Plasmid#128433PurposeEmbty backbone vector for expression of gRNA for spCas9 genome editing or epigenome editingDepositorTypeEmpty backboneExpressionMammalianPromoterU6 promoterAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only