We narrowed to 9,295 results for: control
-
Plasmid#202350PurposeControl neg. ctrl (negative control S70A) in modified pSTC0 vector in which kan resistance cassette is replaced with zeo resistance cassetteDepositorInsertneg. ctrl
Available SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RepoMan-RATA
Plasmid#184270PurposeExpresses shRNA resistant GFP-RepoMan RATA MutantDepositorInsertcell division cycle associated 2 (CDCA2 Human)
Tags3xHA and GFPExpressionMammalianMutationV383A, F395APromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Repo-Man-1-890
Plasmid#184272PurposeExpresses C-terminally truncated GFP-RepoManDepositorInsertcell division cycle associated 2 (CDCA2 Human)
TagsGFPExpressionMammalianMutationtruncated Repo-Man after aminoacid 893PromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RepoMan-T394A
Plasmid#204994PurposeExpresses shRNA resistant GFP-RepoMan T394A MutantDepositorInsertcell devision cycle associated 2 (CDCA2 Human)
TagsGFPExpressionMammalianMutationchanged Threonine 394 to AlaninPromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RepoMan-S893D
Plasmid#204995PurposeExpresses shRNA resistant GFP-RepoMan S893D MutantDepositorInsertcell division cycle associated 2 (CDCA2 Human)
TagsGFPExpressionMammalianMutationchanged Serine 893 to Aspartic acidPromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-NLS-msfGFP-T2A-mCherry-NES> mPGK-PuroR
Plasmid#218916PurposeLentiviral construct expressing msfGFP and nuclear mCherry proteins.DepositorInsertEF1a-msfGFP-T2A-mCherry-NLS > mPGK-PuroR
UseLentiviralAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_131
Plasmid#216095PurposeCas12a [EnAs] CRISPRa targeting CD97, CD4, CD26, CD274, positive controlDepositorInsertCD97, CD4, CD26, CD274 guides
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-NAP1-S37K/A44E (delta-NDP52)
Plasmid#208863PurposeStably express GFP-tagged NAP1 (delta-NDP52) for CID induced mitophagyDepositorInsertNAP1 (AZI2 Human)
TagsFKBP-GFPExpressionMammalianMutationS37K/A44E (disrupts NDP52 binding)Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-NAP1-I11S/L12S (delta-FIP200)
Plasmid#208864PurposeStably express GFP-tagged NAP1 (delta-FIP200) for CID induced mitophagyDepositorInsertNAP1 (AZI2 Human)
TagsFKBP-GFPExpressionMammalianMutationI11S/L12S (disrupts FIP200 binding)Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-NAP1-L226Q/L233Q (delta-TBK1)
Plasmid#208865PurposeStably express GFP-tagged NAP1 (delta-TBK1) for CID induced mitophagyDepositorInsertNAP1 (AZI2 Human)
TagsFKBP-GFPExpressionMammalianMutationL226Q/L233Q (disrupts TBK1 binding)Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Synapsin-SspB-EGFP-VP16-P2A-FLAG-TetR-NLS-CapN-SsrA-CapC
Plasmid#213535PurposeExpresses the split transcription factors in cultured neuron and mouse brainDepositorInsertSspB-EGFP-VP16-P2A-FLAG-TetR-NLS-CapN-SsrA-CapC-HA-HA
UseAAVTagsEGFP and HAExpressionMammalianPromoterSynapsinAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CTRL00509)-PGKpuroBFP-W
Plasmid#211956PurposeExpress non-cutter control gRNA with puro and BFPDepositorInsertnon-cutter control sgRNA_CTRL00509
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CTRL00626)-PGKpuroBFP-W
Plasmid#211957PurposeExpress non-cutter control gRNA with puro and BFPDepositorInsertnon-cutter control sgRNA_CTRL00626
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti4/V5-DEST-AERRIE
Plasmid#204023PurposeLentiviral vector expressing human long non-coding RNA AERRIE (linc01013)DepositorAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
tetO-Fzd1-IRES-tdTomato (TET006)
Plasmid#160510PurposeThis plasmid expresses Fzd1 under the activation of tTA trans-activator along with fluorescent marker tdTomato.DepositorArticleInsertFzd1 (Fzd1 Mouse)
ExpressionMammalianAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-chPKCdelta/eDHFR(69K6)-EGFP
Plasmid#178857PurposeMammalian expression of PKCδ-eDHFR(69K6) chimera fused to EGFPDepositorAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-chPKCdelta/eDHFR(69K6)-miRFP670
Plasmid#178858PurposeMammalian expression of PKCδ-eDHFR(69K6) chimera fused to miRFP670DepositorInsertPKCδ(1-229)-eDHFR(69K6)-PKCδ(280-675)-miRFP670 (PRKCD Human)
ExpressionMammalianPromoterCAGAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-EGFP-eDHFR(69K6)-cRaf
Plasmid#178849PurposeMammalian expression of cRaf fused to EGFP-eDHFR(69K6)DepositorAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-cRaf-mNG-eDHFR(69K6)
Plasmid#172107PurposeMammalian expression of cRaf fused to mNeonGreen-eDHFR(69K6)DepositorAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-63-SFFV-T2A-BlaR-polyA-R11a
Plasmid#179894PurposeDonor with homologous arms for Rab11a to knock in SFFV-T2A-Blasticidin resistance-PolyA cassette (for knock out)DepositorInsertRAB11A, member RAS oncogene family (RAB11A Human)
UseCRISPR; Donor for homologous based knock inExpressionBacterial and MammalianPromoterSFFVAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22gCfpUbiG4FER4P2A(#249)
Plasmid#184070Purposecyclofen-inducible GAL4 activation in zebrafish permanent transgenicDepositorInsertGal4bdFF-ERT2-P2A
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-42-DExCon-antiGFPnanobody-mCherry-R11a
Plasmid#179902PurposeDonor with homologous arms for Rab11a to knock in DExCon-antiGFPnanobody-mCherry moduleDepositorInsertRAB11A, member RAS oncogene family (RAB11A Human)
UseCRISPR; Donor for homologous based knock inTagsantiGFPnanobody-mCherryExpressionBacterial and MammalianPromoterTRE3GSAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-61-SFFV-T2A-PuroR-polyA-R11a
Plasmid#179892PurposeDonor with homologous arms for Rab11a to knock in SFFV-T2A-Puromycin resistance-PolyA cassette (for knock outDepositorInsertRAB11A, member RAS oncogene family (RAB11A Human)
UseCRISPR; Donor for homologous based knock inExpressionBacterial and MammalianPromoterSFFVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-22-DExCon-mNeonGreen-R11a
Plasmid#179897PurposeDonor with homologous arms for Rab11a to knock in DExCon-mNeonGreen moduleDepositorInsertRAB11A, member RAS oncogene family (RAB11A Human)
UseCRISPR; Donor for homologous based knock inTagsmNeonGreenExpressionBacterial and MammalianPromoterTRE3GSAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA T7-Gnat1 Mut-3UTR
Plasmid#184027PurposeExpresses mouse Gnat1 protein with N-terminal T7 tag from cDNA that contains the mutant 3'-UTR where the TAG binding sites for MSI1 are mutated to TGADepositorInsertGnat1 (Gnat1 Mouse)
TagsT7ExpressionMammalianMutationTAG sites in the 3'-UTR are mutated to TGAPromoterCMVAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
S113
Plasmid#174551PurposeConstitutive PhCMV-driven mammalian expression vector of CDH-3-TF cassette (PhCMV-Gal4-mdm2-P2A-LD6-Rel65-pA)DepositorAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1535 pscAAV mU6 shRNA(scram) CMV-IE Nuc-EYFP
Plasmid#135563PurposeAn AAV vector expressing scrambled shRNA and a nuclear EYFP reporterDepositorInsertsshRNA (scrambled)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianPromoterCMV-IE and mU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
PWPXLD-EGFR-P667A
Plasmid#133750PurposeEGFR with mutation at proline 667 converted to alanine and tagged with HA cloned into PWPXLD plasmidDepositorInsertMutant P667A EGFR-HA (EGFR Human)
UseLentiviralTagsHA tagExpressionMammalianMutationproline 667 converted to alanine (Please see depo…PromoterEF1-alphaAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowY-AURKA-mTurq2
Plasmid#157770PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP N1 AURKA deltaNter
Plasmid#157753PurposeExpression of AURKA without Nter, fused to GFP in mammalian cellsDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 AURKA deltaNter
Plasmid#157749PurposeExpression of AURKA without Nter in mammalian cellsDepositorInsertAURKA (AURKA Human)
ExpressionMammalianMutationthe first 30AA of Aurora A are lackingPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
QuasAr-P2A-hKvb1
Plasmid#154083PurposeIndependent expression of QuasAr and human Kvbeta 1 in pFCK vectorDepositorInsertQuasAr-P2A-human Kvb1 (KCNAB1 Human, Synthetic)
UseLentiviralTagsmyc-FlagExpressionMammalianPromoterCaMKIIAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Flag-Hel25E MUT
Plasmid#110122PurposeExpresses Flag-tagged D. melanogaster Hel25E with 4 mutations that impact circRNA nuclear export activityDepositorInsertHel25E (Hel25E Fly)
TagsFlagExpressionInsectMutation4 mutations (KKLN motif changed to RSFS)PromoterMetallothionein Promoter (pMT)Available SinceSept. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT4
Plasmid#127513PurposePlasmid encodes H. sapiens codon optimized Integrase 4.DepositorInsertIntegrase 4 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT5
Plasmid#127514PurposePlasmid encodes H. sapiens codon optimized Integrase 5.DepositorInsertIntegrase 5 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-RNF68 [dRING]
Plasmid#126549PurposeExpresses FLAG-HA-tagged RNF68 [dRING mutant] in mammalian cellsDepositorInsertRNF68 (PCGF1 Human)
UseRetroviralTagsFLAG-HAExpressionMammalianMutationRING domain deletion mutant [dRING mutation is a …PromoterLTRAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2[eb-Tc’bhsp-EGFP-2A-Cre;3xP3-gTc’v-SV40]
Plasmid#124068PurposeCRISPR/Cas mediated knock-in via non-homologous end-joining in Tribolium; bhsp drives EGFP expression; Dm-ebony for linearization; (Transformation plasmid; Black eye marker)DepositorInserteb-Tc’bhsp-EGFP-2A-Cre; 3xP3-gTc’v-SV40
UseCRISPR and Cre/LoxExpressionInsectPromoterbhsp68Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFL-SV40-TAK1 5'-UTR
Plasmid#115356Purposefirefly luciferase (Fluc) reporter containing the 5’-UTR of TAK1 mRNADepositorAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#84
Plasmid#110878PurposeExpresses the C. elegans acy--1 P260S gain-of-function cDNA in ventral cord cholinergic motor neuronsDepositorInsertsunc-17beta promoter
acy-1 P260S gain-of-function cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
ExpressionBacterialMutationChanged Proline to Serine at amino acid 260Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only