We narrowed to 9,048 results for: sgRNA
-
Plasmid#128214Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH75
Plasmid#128224Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmcGAS
Plasmid#208385PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine cGAS gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmSTING
Plasmid#208386PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine STING gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCC_07 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-dxCas9-NLS-VPR-2A-Puro-WPRE
Plasmid#139092PurposeExpresses human codon-optimized inactive xCas9 3.7 fused to a transcriptional activator VPR in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertdxCas9 3.7-VPR
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, A262T, R324L,S409I, E480K, E543D, M6…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMLS1272
Plasmid#188891PurposeRic-4 sgRNA expression vectorDepositorInsertPU6(R07E5.16)::Ric-4 sgRNA (CELE_Y22F5A.3 Nematode)
ExpressionWormAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA104
Plasmid#245326PurposeCas9 CRISPRa positive control guide; targets CD4DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLP17_Lenti α-syn
Plasmid#239419PurposeLentiviral plasmid for SpCas9-based CRISPR KO of mouse α-synDepositorInsertmouse a-synuclein sgRNA (Snca Mouse)
UseLentiviralAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#2-puro
Plasmid#231982PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#1-puro
Plasmid#231981PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sABE v3.22 Lenti_2
Plasmid#209556PurposepU6-SpCas9_sgRNA-pCMV-bpSV40_NLS-TadA-8e (2-76)-2xFRBDepositorInsertSpCas9 sgRNA, TadA-8e (2-76)-2xFRB
ExpressionMammalianPromoterpU6, pCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-2
Plasmid#109009PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1NT
Plasmid#62255Purposeexpression of A1NT sgRNA from the arabinose-inducible promoterDepositorInsertA1NT
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX(Cas12k-TniQ)-sgRNA_entry (CJT111)
Plasmid#181790PurposeExpresses 3-component ShHELIX containing a Cas12k-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShCas12k-ShTniQ
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbVPE1a/b
Plasmid#223218PurposeExpresses an sgRNA targeting the NbVPE1a/b genes in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbVPE1a/b
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbCysP6
Plasmid#223217PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbCysP6 sgRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-MYO1C
Plasmid#227305PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of MYO1C for knock-in.DepositorInsertsgRNA Targeting N-terminus of MYO1C (MYO1C Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330 EGFR-sgRNA
Plasmid#188633PurposeA human codon-optimized SpCas9 and chimeric guide RNA targeting C-terminus of human EGFRDepositorInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only