We narrowed to 46,632 results for: cha;
-
Plasmid#45702DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only
-
Kv7.4 AB (325-557, Δ 368-523)/pET28HMT
Plasmid#111052PurposeProtein expression in E.ColiDepositorInsertpotassium voltage-gated channel subfamily KQT member 4 isoform a [Homo sapiens] (KCNQ4 Human)
TagsHis Tag and MBP tagExpressionBacterialMutationKv7.4 AB (325-557, Δ 368-523)PromoterT7Available SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBp-FGFR2c-K660E
Plasmid#45706DepositorAvailable SinceJune 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBp-FGFR2c-T787K
Plasmid#45710DepositorAvailable SinceJune 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBp-FGFR2b-T787K
Plasmid#45709DepositorAvailable SinceJune 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBp-FGFR2b-E471Q
Plasmid#45703DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(5)
Plasmid#193573PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a rigid alpha helix of 5 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(6)
Plasmid#193574PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a rigid alpha helix of 6 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(7)
Plasmid#193575PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a rigid alpha helix of 7 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(flex5)
Plasmid#193576PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a flexible linker of 5 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(flex6)
Plasmid#193577PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a flexible linker of 6 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(flex7)
Plasmid#193578PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a flexible linker of 7 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CPH3400 (YCp LEU2 Rpb1 A1529_G1534delInsLEVLFQGP)
Plasmid#91806PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationResidues A1529-G1534 replaced with a PreScission …PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3477 (YCp LEU2 Rpb1 P1455_E1456InsLEVLFQGP)
Plasmid#91807PurposeYeast expression of S. cerevisiae Rpb1 with an internal PreScission protease siteDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationPreScission Protease site (LEVLFQGP) inserted bet…PromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-XMod-Doc (BMB-KO, S199AzF)-HIS
Plasmid#153445PurposeE. coli expression (amber suppression) of Rc. XDocB binding mode B knock-out mutant with serine at position 199 replaced with amber codon.DepositorInsertRc.XDocB
Tags6xHis and ybbr tagExpressionBacterialMutationSerine 199 was mutated to amber codon (TAG). Argi…PromoterT7 promoterAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-XMod-Doc (BMA-KO, S199AzF)-HIS
Plasmid#153444PurposeE. coli expression (amber suppression) of Rc. XDocB binding mode A knock-out mutant with serine at position 199 replaced with amber codon.DepositorInsertRc.XDocB
Tags6xHis and ybbr tagExpressionBacterialMutationSerine 199 was mutated to amber codon (TAG). Argi…PromoterT7 promoterAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBp-FGFR2c-E471Q
Plasmid#45704DepositorAvailable SinceJune 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
Kv7.5 AB (361-545, Δ395-511)/pET28HMT
Plasmid#111267PurposeProtein expression in E.ColiDepositorInsertpotassium voltage-gated channel subfamily KQT member 5 isoform 1 [Homo sapiens] (KCNQ5 Human)
TagsHis Tag and MBP TagExpressionBacterialMutationKv7.5 AB (361-545, Δ395-511)PromoterT7AvailabilityAcademic Institutions and Nonprofits only -
Kv7.4 AD (325-645, C643A, Δ 368-492)/pET28HMT
Plasmid#111072PurposeProtein expression in E.ColiDepositorInsertpotassium voltage-gated channel subfamily KQT member 4 isoform a [Homo sapiens] (KCNQ4 Human)
TagsHis Tag and MBP tagExpressionBacterialMutationKv7.4 AD (325-645, C643A, Δ 368-492)PromoterT7AvailabilityAcademic Institutions and Nonprofits only