We narrowed to 11,193 results for: ENA
-
Plasmid#186707PurposeCYP110D1 coding sequence under the control of PpsbA2* promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyPromoterPpsbA2*Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::Ptrc.x.tetO2::B0032::CYP110D1
Plasmid#186709PurposeCYP110D1 coding sequence under the control of Ptrc.x.tetO2 promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyPromoterPtrc.x.tetO2Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOD_004
Plasmid#155361PurposeGentamycin version of the scarless genome engineering pDEL plasmid (Tikh et al. 2016) compatible with SalmonellaDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOD_003
Plasmid#155362PurposeZeomycin version of the scarless genome engineering pDEL plasmid (Tikh et al. 2016) compatible with SalmonellaDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBA1031
Plasmid#189584PurposeEdH4gp0214 deletion HR vector 250bp HR Arms (EdH4 phage editing)DepositorInsertEdH4gp0214 Deletion Locus 250bp Homology Arms
UseSynthetic BiologyExpressionBacterialMutationEncodes for a full deletion of EdH4gp0214Available SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBA1030
Plasmid#189582PurposeEdH4gp0004 deletion HR vector 250bp HR Arms (EdH4 phage editing)DepositorInsertEdH4gp0004 Deletion Locus 250bp Homology Arms
UseSynthetic BiologyExpressionBacterialMutationEncodes for a full deletion of EdH4gp0004Available SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MTOR
Plasmid#183311PurposeAll-in-One CRISPRko system with a guide RNA that targets MTOR geneDepositorInsertMTOR
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BRAF
Plasmid#183273PurposeAll-in-One CRISPRko system with a guide RNA that targets BRAF geneDepositorInsertBRAF
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEUK028
Plasmid#180826PurposeT7-inducible expression construct to produce SwGdmA (SWIT_RS16490) in E. coliDepositorArticleInsertSwGdmA (SWIT_RS16490 Synthetic, Sphingomonas wittichii RW1)
Tags6X HisExpressionBacterialPromoterT7Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEUK037
Plasmid#180829PurposeT7-inducible expression construct to produce CnGdmB (CNE_RS35790) in E. coliDepositorArticleAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEUK066
Plasmid#180830PurposeT7-inducible expression construct to produce NaGdmA (SARO_RS07455) in E. coliDepositorArticleInsertNaGdmA
Tags6X HisExpressionBacterialPromoterT7Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CYP19A1
Plasmid#183280PurposeAll-in-One CRISPRko system with a guide RNA that targets CYP19A1 geneDepositorInsertCYP19A1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DHFR
Plasmid#183281PurposeAll-in-One CRISPRko system with a guide RNA that targets DHFR geneDepositorInsertDHFR
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FLT1
Plasmid#183292PurposeAll-in-One CRISPRko system with a guide RNA that targets FLT1 geneDepositorInsertFLT1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_YES1
Plasmid#183329PurposeAll-in-One CRISPRko system with a guide RNA that targets YES1 geneDepositorInsertYES1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TYMS
Plasmid#183326PurposeAll-in-One CRISPRko system with a guide RNA that targets TYMS geneDepositorInsertTYMS
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ROS1
Plasmid#183320PurposeAll-in-One CRISPRko system with a guide RNA that targets ROS1 geneDepositorInsertROS1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only