This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser.
Learn more
Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected].
Learn more
Donor template for Puro-2A-mScarlet insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748
Broad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorT signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasm
Donor template for Blast-2A-mScarlet insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748
Expressed ABA-inducible dimerizing KRAB-dCas9 system, with KRAB-IRES-Blasticidin resistance under CAG promoter and tagBFP-dCas9-FKBP12 (F36V mutant) degron under PGK promoter in a piggyBac plasmid.
SMASh degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.
Donor template for moxGFP-2A-Puro insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780
Expresses N-terminus of split luciferase fused to antiparallel coiled-coil AP10 connected with autoinhibitory coil P9mS and PPVs cleavage site in antiparallel harpin linker/for SPOC logic
pNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI and
All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.
Provides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid part for C-terminal fusions
pMAGIC L1-R5 entry plasmid, contains empty human U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion
For recombinant expression of the full heavy chain of the Mouse anti-MUC1 antibody 139H2 in mammalian cells. Includes a C-terminal -His8 tag for purification.