We narrowed to 15,273 results for: grn

#90278

BB3_L 23_gRNAempty_cas9_BbsI; CRISPR plasmid with empty gRNA spacer to incorporate gRNA, Cas9

Michael Sauer

Sarkari et al Bioresour Technol. 2017 May 4. pii: S096

July 19, 2017

Academic Institutions and Nonprofits only

1 Article

#89954

Contains arabinose-induced lambda Red and a tet-inducible gRNA targeting hisG.

Michael Lynch

Moreb et al ACS Synth Biol. 2017 Oct 2. doi: 10.1021

July 12, 2017

Academic Institutions and Nonprofits only

#89964

Contains arabinose-induced lambda Red and a tet-inducible gRNA targeting xylA.

Michael Lynch

Moreb et al ACS Synth Biol. 2017 Oct 2. doi: 10.1021

June 19, 2017

Academic Institutions and Nonprofits only

#89959

Contains arabinose-induced lambda Red and a tet-inducible gRNA targeting lpoB.

Michael Lynch

Moreb et al ACS Synth Biol. 2017 Oct 2. doi: 10.1021

June 19, 2017

Academic Institutions and Nonprofits only

#89955

Contains arabinose-induced lambda Red and a tet-inducible gRNA targeting trmI.

Michael Lynch

Moreb et al ACS Synth Biol. 2017 Oct 2. doi: 10.1021

June 19, 2017

Academic Institutions and Nonprofits only

1 Article

#87409

p426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87391

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87392

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87395

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87397

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87400

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#81210

for targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 3' of gix site)

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only

#81216

pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch12 reporter

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only

#81207

for targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 5' of gix site)

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only

#81208

for targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 5' of gix site)

David Liu

Chaikind et al Nucleic Acids Res. 2016 Aug 11. pii: gkw

Nov. 4, 2016

Academic Institutions and Nonprofits only

#72890

plasmid to generate guideRNA against mmp21 gene in zebrafish

Nicholas Katsanis

Perles et al J Med Genet. 2015 Dec;52(12):840-7. doi:

Feb. 16, 2016

Academic Institutions and Nonprofits only