We narrowed to 44,705 results for: cha
-
Plasmid#184885PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pECNUS3
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSP64-mHCN2
Plasmid#53060PurposeExpresses alpha subunit of mouse HCN2 channel in Xenopus oocytesDepositorInsertPotassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2 (Hcn2 Mouse)
UseXenopus oocyte expressionMutationE55G, R237H, and K283R polymorphisms compared to …PromoterSP6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
Syn-ATP
Plasmid#51819PurposeOptical reporter of presynaptic ATPDepositorInsertChimeric Synaptophysin-mCherry-Luciferase
ExpressionMammalianMutationWithin WT luciferase gene, changed Threonine 214 …PromoterCMVAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CPH3486 (YCp LEU2 Rpb1 F1492A)
Plasmid#91808PurposeYeast expression of S. cerevisiae Rpb1 with a F1492A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged phenylalanine 1492 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3487 (YCp LEU2 Rpb1 S1493A)
Plasmid#91809PurposeYeast expression of S. cerevisiae Rpb1 with a S1493A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged serine 1493 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3488 (YCp LEU2 Rpb1 P1494A)
Plasmid#91810PurposeYeast expression of S. cerevisiae Rpb1 with a P1494A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged proline 1494 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CPH3508 (YCp LEU2 Rpb1 Y1473A)
Plasmid#91811PurposeYeast expression of S. cerevisiae Rpb1 with a Y1473A mutationDepositorInsertRPO21 (RPO21 Budding Yeast)
ExpressionYeastMutationchanged tyrosine 1473 to alaninePromoterEndogenous Rpb1 promoterAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only