We narrowed to 10,492 results for: nar
-
Plasmid#120293PurposeAAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffoldDepositorInsertN-terminal fragment of SpyCas9
UseAAV and CRISPRTagsSV40-NLS and split-inteinExpressionMammalianMutationPromoterAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PEA1-GFP
Plasmid#171993PurposeDelivers all prime editing nickase components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseTagsExpressionMammalianMutationPromoterCMV for Cas9, U6 for gRNAsAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
WN10150
Plasmid#80443PurposeExpresses dead (908A) AsCpf1DepositorInsertnuclease dead (908A) AsCpf1
UseTagsNLS-3xHAExpressionMammalianMutationnuclease dead (D908A)PromoterAvailable sinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-Rainbow
Plasmid#206252PurposeExpression of 7 fluorescently labelled proteins in mammalian cells. Can be used to generate recombinant baculovirus particles.DepositorInsertH2B (human); Actin, Tubulin (B. taurus); mito mCherry, GST mTagBFP1 (Synthetic); CyOFP1 (E. quadricolor); Ctnnb1 (mouse)
UseRecombinant baculovirus production (bac-to-bac)TagsiRFP713ExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19_Ntag_BbsI-Mammalian
Plasmid#186674PurposeN-terminal tag cassette with BbsI restriction sites for CRISPR donor plasmid.DepositorInsertMammalian N-terminal Tag
UseTags3xFlag-3xHAExpressionMammalianMutationPromoterAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-Cell-cycle
Plasmid#206280PurposeExpression of a FUCCI cell cycle sensor with a H2B iRFP713 chromatin reporter. Can be used to generate recombinant baculovirus particles.DepositorInsertH2B iRFP713, mAG-hGeminin, mKO2-hCdt1
UseRecombinant baculovirus productionTagsExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-HA_WT POLH
Plasmid#201671PurposeExpression of WT DNA polymerase eta with an N-terminal HA tag in mammalian cellsDepositorInsertPolymerase eta (POLH Human)
UseTagsHAExpressionMammalianMutationCoding sequence has been optimised for expression…PromoterCMVAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-hCdt1-HA
Plasmid#117500PurposeExpresses human Cdt1 fused to HA tagDepositorInsertCdc10-dependent transcript-1 (CDT1 1700 bp, Human)
UseTagsHAExpressionMammalianMutationwild-typePromoterCMVAvailable sinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMA7-SacB
Plasmid#79968PurposeTM-MAGE strainDepositorInsertsLambda Red recombinase beta subunit
DNA adenine methylase
Levansucrase
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterpBADAvailable sinceSept. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
SlugCas9-HF
Plasmid#163796PurposeExpresses highly specific SlugCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationSlugCas9 (R247A, N415A, T421A, R656A)PromoterAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmax
Plasmid#206883PurposeExpresses FLAG-tagged PEmax fused to Gag through a linker sequenceDepositorInsertPEmax
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterCMVAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-TET1_CD
Plasmid#83570PurposeExpresses the catalytic domain of TET1 in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
UseTags3X FLAG tag and hr GFP IIExpressionMammalianMutationTET1 amino acids 1-1417 deletedPromoterCMVAvailable sinceAug. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1 Clover-LMNA Donor
Plasmid#122508PurposeHomology repair template for in frame (first exon) clover knock-in of human LMNA geneDepositorInsertHomology Repair Template for Human LMNA (N-Terminal Clover Tag) (LMNA Human)
UseHomology repair template plasmid (donor plasmid)TagsCloverExpressionMutationPromoterAvailable sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralTagsExpressionMutationPromoterpCMV and U6Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRY-Gal∆DD (B1013)
Plasmid#92035PurposeExpresses CRY2 (full-length, with endogenous NLS) fused to Gal4 (aa1-65 of Gal4BD), downstream of mCherry-IRESDepositorInsertCRY2 (CRY2 Mustard Weed)
UseTagsExpressionMammalianMutationFusion of plant CRY2 to Gal4 binding domain (AA1-…PromoterAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-2C-NLS in pCSDest
Plasmid#126638PurposeExpresses LbCas12a-2C-NLS in mammalian cellDepositorInsertLbCas12a-2C-NLS
UseCRISPRTags3xHuman influenza hemagglutinin (HA)-TagExpressionMammalianMutationPromoterCMV IE94 promoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC
Plasmid#62806PurposeTo express genes at high levels in neuronal cells. This UbC promoter is more active in neurons than the promoter in CMV-based vectors.DepositorTypeEmpty backboneUseAAV; EucaryoticTagsExpressionMammalianMutationPromoterhUbCAvailable sinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-ABE8e
Plasmid#206882PurposeExpresses FLAG-tagged ABE8e fused to Gag through a linker sequenceDepositorInsertABE8e
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterCMVAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
CIB-VP64 (B1016)
Plasmid#92037PurposeExpresses CIB1 (Full-length, with endogenous NLS) fused to VP64 activation domain (4xVP16 inserts)DepositorInsertCIB1-VP64 (CIB1 Mustard Weed)
UseTagsFusion of plant CIB1 with VP64 activation domain.…ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only