We narrowed to 3,367 results for: aaas
-
Plasmid#77281Purpose3rd generation lentiviral gRNA plasmid targeting human GSK3BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
CDK14 gRNA (BRDN0001147002)
Plasmid#76638Purpose3rd generation lentiviral gRNA plasmid targeting human CDK14DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK14 gRNA (BRDN0001146521)
Plasmid#76639Purpose3rd generation lentiviral gRNA plasmid targeting human CDK14DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
KSR2 gRNA (BRDN0001148172)
Plasmid#76426Purpose3rd generation lentiviral gRNA plasmid targeting human KSR2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_v1_Dual_epegRNA_tevopreQ1
Plasmid#187458PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 epegRNA (tevopreQ1) with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N epegRNA (tevopreQ1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
BRD3 gRNA (BRDN0001146442)
Plasmid#76092Purpose3rd generation lentiviral gRNA plasmid targeting human BRD3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC1A7
Plasmid#131998PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC1A7 (SLC1A7 Human)
ExpressionMammalianAvailable SinceOct. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
CDK4 gRNA (BRDN0001147572)
Plasmid#76178Purpose3rd generation lentiviral gRNA plasmid targeting human CDK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-shCasp2-IRES-GFP
Plasmid#52061Purposestable knockdown of Caspase-2 in mammalian cellsDepositorAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA4
Plasmid#136459PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
CLK2 gRNA (BRDN0001145900)
Plasmid#77607Purpose3rd generation lentiviral gRNA plasmid targeting human CLK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
rd-his
Plasmid#112911PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tag and non-cleavable C-terminal 6-his tagDepositorInsertdematin (DMTN Human)
Tags6-his tag, Glutathione-S-Transferase, and preciss…ExpressionBacterialMutation89KSTSPPPSPEVWAD102 was replaced with 89KAAAGGGAG…PromoterT7Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
CKMT2 gRNA (BRDN0001147363)
Plasmid#76595Purpose3rd generation lentiviral gRNA plasmid targeting human CKMT2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CKMT2 gRNA (BRDN0001147460)
Plasmid#76596Purpose3rd generation lentiviral gRNA plasmid targeting human CKMT2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CKMT2 gRNA (BRDN0001148542)
Plasmid#76597Purpose3rd generation lentiviral gRNA plasmid targeting human CKMT2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:mTREK-1_cryst
Plasmid#133269PurposeP. pastoris expression vector. It will generate the mouse TREK-1 channel (21-322) fused to a C-terminal GFPDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 Mouse)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationaa 21-322, K84R, Q85E, T86K, I88L, A89R, Q90A, A9…Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
RPS6KB1 gRNA (BRDN0001145729)
Plasmid#75612Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KB1 gRNA (BRDN0001145927)
Plasmid#75613Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-Grpr1
Plasmid#175176PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting GrprDepositorInsertsgRNA-Grpr
UseAAV and CRISPRAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only