We narrowed to 24,925 results for: crispr
-
Plasmid#178091PurposeExpresses the NPM1 G6 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with NPM1_mNeonGreen_Donor to tag NPM1 with mNeonGreen. pX330-like plasmid.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNPM1 G6 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable sinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pForge-CRISPR-Acceptor-PuroR-mScarlet
Plasmid#258801PurposeCRISPR acceptor with PuroR and mScarletDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceJuly 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pForge-CRISPR-Acceptor-Cas9-GFP
Plasmid#258802PurposeCRISPR vector with Cas9 and GFPDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceJuly 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pForge-CRISPR-Acceptor-PuroR-GFP
Plasmid#258800PurposeCRISPR acceptor with PuroR and GFPDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceJuly 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTE3331
Plasmid#107536PurposeExpresses Fn crRNA and human codon optimized FnCpf1(RVR mutant) in mammalian cells.DepositorInsertsFn crRNA
hFnCpf1(RVR mutant)
Tags3xHA and NLSExpressionMammalianMutationN607R, K613V, N617RPromoterCMV and human U6Available sinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE3336
Plasmid#107541PurposeExpresses Mb crRNA and human codon optimized MbCpf1(RR mutant) in mammalian cells.DepositorInsertsMb crRNA
hMbCpf1(RR mutant)
Tags3xHA and NLSExpressionMammalianMutationN576R, K637RPromoterCMV and human U6Available sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE3333
Plasmid#107540PurposeExpresses Fn crRNA and human codon optimized FnCpf1(RR mutant) in mammalian cells.DepositorInsertsFn crRNA
hFnCpf1(RR mutant)
Tags3xHA and NLSExpressionMammalianMutationN607R, K671RPromoterCMV and human U6Available sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-V2_mMSH2
Plasmid#186156PurposesgRNA targeting murine Msh2 geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMsh2_gRNA (Msh2 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pForge-CRISPR-Module-Single-Guide
Plasmid#258796PurposeModule to accept single CRISPR guidesDepositorTypeEmpty backboneUseCRISPRAvailable sinceJuly 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFS_0385_pET30-RT-CRISPR_Rivularia_sp._PCC_7116_ARRAY_1
Plasmid#116997PurposeExpresses RPCC7116RT-Cas1-Cas2 under pT7lac promoter, encodes RPCC7116CRISPR array 1, compatible with SENECA acquisition readoutDepositorInsertRivularia sp. PCC 7116 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available sinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0387_pET30-RT-CRISPR_Rivularia_sp._PCC_7116_ARRAY_2
Plasmid#116999PurposeExpresses RPCC7116RT-Cas1-Cas2 under pT7lac promoter, encodes RPCC7116CRISPR array 2, compatible with SENECA acquisition readoutDepositorInsertRivularia sp. PCC 7116 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available sinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0388_pET30-RT-CRISPR_Rivularia_sp._PCC_7116_ARRAY_2_RC
Plasmid#117000PurposeExpresses RPCC7116RT-Cas1-Cas2 under pT7lac promoter, encodes RPCC7116CRISPR array 2 RC, compatible with SENECA acquisition readoutDepositorInsertRivularia sp. PCC 7116 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available sinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0386_pET30-RT-CRISPR_Rivularia_sp._PCC_7116_ARRAY_1_RC
Plasmid#116998PurposeExpresses RPCC7116RT-Cas1-Cas2 under pT7lac promoter, encodes RPCC7116CRISPR array 1 RC, compatible with SENECA acquisition readoutDepositorInsertRivularia sp. PCC 7116 RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available sinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0347_pET30-RT-CRISPR_Campylobacter_fetus_subsp._Fetus_ARRAY_1
Plasmid#116959PurposeExpresses CfRT-Cas1-Cas2 under pT7lac promoter, encodes CfCRISPR array 1, compatible with SENECA acquisition readoutDepositorInsertCampylobacter fetus subsp. Fetus RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available sinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0348_pET30-RT-CRISPR_Campylobacter_fetus_subsp._Fetus_ARRAY_1_RC
Plasmid#116960PurposeExpresses CfRT-Cas1-Cas2 under pT7lac promoter, encodes CfCRISPR array 1 RC, compatible with SENECA acquisition readoutDepositorInsertCampylobacter fetus subsp. Fetus RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available sinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
ABE8e (V106W)
Plasmid#257823PurposeABE8e(V106W) Sp Cas9 IVT plasmidDepositorInsertABE8e (V106W) SpCas9
ExpressionMammalianAvailable sinceJune 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-As
Plasmid#209026PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only