We narrowed to 2,985 results for: erf
-
Plasmid#224846PurposePlasmid for expression of AT4G33650.1 coding sequence tagged with mKOk in plantsDepositorInsertAT4G33650.1 (DRP3A Mustard Weed)
ExpressionPlantAvailable sinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMDA5_2g)-PGKpuro2AmCherry-W
Plasmid#208436PurposeLentiviral gRNA plasmid targeting human MDA5 gene, co-expression of mCherry tagDepositorInsertMDA5 (IFIH1 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U10Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_E307K
Plasmid#234560PurposeCTNNA1 butterfly eye mutantDepositorAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-IFIT5_WT-VA
Plasmid#191221PurposeLentiviral expression of human IFIT5_WT in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTagsVA tagExpressionMammalianPromoterCMVAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
prCOrev
Plasmid#153961PurposeUsed to detect crossover-type DNA recombination events elicited by iso-positional nicking of two homologous DNA fragments (recombination analogous to Holliday's model)DepositorInsert5' and 3' EGFP fragments sharing a 386-bp sequence, separated by a NeoR gene cassette and arranged in the opposite direction
UseRetroviral; A reporter plasmid detecting dna reco…TagsNLS-ZFExpressionMammalianMutationNo mutationPromoterLTRAvailable sinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
prCO
Plasmid#153960PurposeUsed to detect crossover-type DNA recombination events elicited by iso-positional nicking of two homologous DNA fragments (recombination analogous to Holliday's model)DepositorInsert5' and 3' EGFP fragments sharing a 386-bp sequence, separated by a NeoR gene cassette and arranged in the same direction
UseRetroviral; A reporter plasmid detecting dna reco…TagsNLS-ZFExpressionMammalianMutationNo mutationPromoterLTRAvailable sinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34∆RBS
Plasmid#247213PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available sinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP35∆RBS
Plasmid#247214PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available sinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHNF4A-Enh_Gsta2-IRES2-H2BeGFP
Plasmid#247049PurposeThis plasmid was employed to generate the mouse model used in this study. It contains the human HNF4A gene enhancer linked to the Shh mini-promoter and the Gsta2-IRES2-H2BeGFP. Homologous armDepositorInsertGlutathione S-Transferase Alpha 2 (Gsta2 Mouse)
ExpressionMammalianAvailable sinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hADAR1_1k)-PGKpuro2ABFP-W
Plasmid#208433PurposeLentiviral gRNA plasmid targeting human ADAR1 gene, co-expression of BFP tagDepositorInsertADAR1 (ADAR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U7Available sinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC[∆2-83]-His+MFN2-Strep (SB259)
Plasmid#227608PurposeInducible coexpression of His-tagged SLC25A46 in its N-terminal region (∆2-83) and Strep-tagged MFN2 in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastMutationaa 2-83 deletedPromoterAOX1Available sinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+MFN2-Strep (SB255)
Plasmid#227604PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged MFN2 in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastPromoterAOX1Available sinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-STING L373A with IRSp53 pLxIS
Plasmid#221283PurposeExpression of STING L373A with IRSp53 pLxIS (RLL361NLV) in mammalian cells by retroviral transductionDepositorUseRetroviralTags3xFLAG-4xFKBPAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Bla-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196081PurposeInducible CRISPRi vector conferring blasticidin S resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196083PurposeInducible CRISPRi vector conferring hygromycin B resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Bla-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196075PurposeConstitutive CRISPRi vector conferring blasticidin S resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Hyg-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196077PurposeConstitutive CRISPRi vector conferring hygromycin B resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCALNL-tdTomato-2A-mSyp::EGFP
Plasmid#191213PurposeExpresses tdTomato protein and mouse Synaptophysin protein fused with EGFP in Cre expressing mammalian cells.DepositorAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HseIF4G1-L640AV646A_AD
Plasmid#148520PurposeMammalian Expression of HseIF4G1-L640AV646ADepositorInsertHseIF4G1-L640AV646A (EIF4G1 Human)
ExpressionMammalianMutationone non silent mutation M432V (natural variant is…Available sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only