We narrowed to 2,981 results for: erf
-
Plasmid#191224PurposeLentiviral expression of human IFIT5_K206R in mammalian cellsDepositorInsertinterferon-induced protein with tetratricopeptide repeats 5 (IFIT5 Human)
UseLentiviralTags3xFlag-TEVx2-6xHis-Strep x2 tag and VA tagExpressionMammalianMutationchanged Lysine 206 to Arginine (K206R)PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+MFN2[∆TM]-Strep (SB260)
Plasmid#227609PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged MFN2 lacking its transmembrane region in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastMutationcontains aa 2-544, 651-757 only [TM deleted]PromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+MFN2[∆TM,∆HB2]-Strep (SB261)
Plasmid#227610PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged MFN2 lacking its transmembrane region and helical bundle 2 (HB2) in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastMutationcontains aa 2-400, 706-757 [TM and HB2 deleted]PromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
EC2_2_dCas9_VP64_sgRNA
Plasmid#163707PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and VP64 activation domainDepositorInsertsdCas9
VP64+SV40 NLS
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
Donor-PIGA-NeoR
Plasmid#153549PurposeUsed as a donor vector for the targeted knock-in of a PIGA mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant PIGA (a 1,991-bp fragment from intron 5 and exon 6 with a 3-bp mutation in exon 6), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AMutationa 3-bp mutation in exon 6PromoterNo promoterAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g3 (BB36)
Plasmid#139454PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g2 (BB35)
Plasmid#139453PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-TYK2(delta)KL-VSV
Plasmid#139352PurposeExpression of TYK2 protein missing the kinase-like (pseudokinase) domainDepositorInsertTYK2 cDNA deleted of aa594-877 with a Tyr inserted after aa593 (TYK2 Human)
TagsVSVExpressionMammalianMutationV362F-deletion of aa 594-877PromoterCMVAvailable SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-Loop
Plasmid#124551PurposeChimeric ETS domain: Loop of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 216 to 223 replaced with corresponding s…Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-DmThor_50-83-P66KP71Q-GB1_AD
Plasmid#148516PurposeBacterial Expression of DmThor_50-83-P66KP71QDepositorInsertDmThor_50-83-P66KP71Q (Thor Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
Donor-CD55-NeoR
Plasmid#153551PurposeUsed as a donor vector for the targeted knock-in of a CD55 mutation. This plasmid carries a neomycin resistance gene cassetteDepositorInsertmutant CD55 (a 1415-bp fragment from intron 3, exon 4 and intron 4, with a 1-bp mutation in exon 4), divided into 5' and 3' arms
UseAAV and Cre/Lox; Donor plasmid/targeting vectorTagsN/AMutationa 1-bp mutation in exon 4PromoterNo promoterAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-Wing
Plasmid#124552PurposeChimeric ETS domain: Wing of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationThe 5 residues making up the "wing" in …Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-DmThor_50-63-DmeIF4Ga_631-638-DmThor_72-83-GB1_AD
Plasmid#148514PurposeBacterial Expression of DmThor_50-63-DmeIF4Ga_631-638-DmThor_72-83DepositorInsertDmThor_50-63-DmeIF4Ga_631-638-DmThor_72-83 (Thor Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-DmThor_50-63-DmeIF4Ga_631-675-GB1_AD
Plasmid#148515PurposeBacterial Expression of DmThor_50-63-DmeIF4Ga_631-675DepositorInsertDmThor_50-63-DmeIF4Ga_631-675 (Thor Fly)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-UbC-3xNLS-mScarlet-I
Plasmid#191099PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-mScarlet-I
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationoptimized to human codon usagePromoterUbCAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v2-10 (-cyt)
Plasmid#137825Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v2-10 (-cyt) (CD44 Human)
TagsGFPExpressionMammalianMutationwithout cytoplasmic region - N213S on the CD44 re…PromoterPGKAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mEGFPm-IFNAR1(28-557)
Plasmid#192704PurposeExpression of SNAPf and mEGFPm-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and meGFPm…ExpressionMammalianMutationmeGFPm: gluatmic acid 142 to asparagine and histi…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPm-IFNAR1(28-557)
Plasmid#192784PurposeExpression of SNAPf and mXFPm-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPmExpressionMammalianMutationmXFPm: tryptophan 66 to phenylalanine, gluatmic a…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag
Plasmid#210021PurposeExpression of transferrin receptor transmembrane domain and photocaged SpyCatcher003(K31HCK)-sfGFP on mammalian cell surface.DepositorInsertTransferrin receptor transmembrane domain-SpyCatcher003(K31TAG)-superfolderGFP-MycTag-CTag (TFRC Human, Synthetic)
TagsMycTag, CTagExpressionMammalianMutationTransferrin receptor transmembrane domain with Y2…PromoterCMV promoterAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only