We narrowed to 2,515 results for: gcg
-
Plasmid#177220PurposeExpresses a Lkb1-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgLkb1_1st/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgNT-hU6-sgLkb1_1st
Plasmid#177221PurposeExpresses a Lkb1-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgNT1/sgLkb1_1st
UseLentiviralPromotermU6/hU6Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik3_2nd-hU6-sgNT
Plasmid#177215PurposeExpresses a Sik3-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgSik3_2nd/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik3_1st-hU6-sgNT
Plasmid#177214PurposeExpresses a Sik3-targeting and a non-targeting gRNAs and Cre-recombinaseDepositorInsertsgSik3_1st/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
SGEP-sh-Hs-PHGDH-1957
Plasmid#188674PurposeshRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik1_2nd-hU6-sgNT
Plasmid#177213PurposeExpresses a Sik1-targeting (mU6) and a non-targeting (hU6) gRNAs and Cre recombinaseDepositorInsertsgSik1_2nd/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgSik1_1st-hU6-sgNT
Plasmid#177212PurposeExpresses a Sik1-targeting (mU6) and non-targeting (hU6) gRNAs, and Cre-recombinaseDepositorInsertsgSik1_1st/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-LacZvsSaCas9 sgRNA
Plasmid#107049PurposeAll-in-one vectors expressing both SaCas9 and LacZ sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 3' Hp1a gRNA
Plasmid#127898PurposeWT Cas9 Vector targeting the 3' end of the mouse Hp1a geneDepositorInsertgRNA/Cas9
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
1197R_gZBF-ER
Plasmid#241825PurposegRNA expressing plasmid with broken SEPARATORDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ CUL3
Plasmid#126891PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ PLDbeta1
Plasmid#126890PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ CUL3
Plasmid#126903PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ PLDbeta1
Plasmid#126902PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYJ14-PB-U6-ND1-acti-gRNA3
Plasmid#131058PurposeActivation of NeuroD1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Actb Donor;3xV5 KO;Dlg4
Plasmid#240292PurposeKI:Actb Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Actb
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
1197TCC_gZBF-HG
Plasmid#241826PurposepgSIT 2.0 gRNA expressing plasmid with working HR5Ie1-EGFP SEPARATOR cassetteDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgNtsr1(guide_2)
Plasmid#205417PurposeMutagenesis of Ntsr1, second guideDepositorAvailable SinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only