We narrowed to 165,652 results for: Gene
-
Plasmid#226706PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from CaMV 35S promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-UBI
Plasmid#226707PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from maize ubiquitin (ZmUbi) promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA8
Plasmid#196103PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196106, 196107, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA9
Plasmid#196108PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196103, 196106, 196107DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA19-HSPB1 5'HA-TriTag (mTagBFP)-3'HA (HDR donor)
Plasmid#199450PurposeCRISPR donor plasmid to insert TriTag (mTagBFP harbors 12XMS2 in its intron) into the C-terminus of human HSPB1 geneDepositorInsertHDR donor template
UseCRISPRAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA20-HSPB1 5'HA-mTagBFP-3'-UTR 12XMS2V5-3'HA (HDR donor)
Plasmid#199451PurposeCRISPR donor plasmid to insert [mTagBFP-stop-12XMS2] into the C-terminus of human HSPB1 gene; 12XMS2 locates in the 3' UTR regionDepositorInsertHDR donor template
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA21-HSPB1 5'HA-NarTag (12XPP7)-3'HA (HDR donor)
Plasmid#199452PurposeCRISPR donor plasmid to insert NarTag (mTagBFP harbors 12XPP7 in its intron) into the C-terminus of human HSPB1 geneDepositorInsertHDR donor template
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins1
Plasmid#195038PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tDEG1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-PGK-dt/CBA-EGFP-NLS
Plasmid#163918PurposeContains bidirectional reporter genes dtomato and nuclear-targeting EGFP.DepositorInsertdtomato and EGFP
UseLentiviralExpressionMammalianMutationAdded nuclear localization signal to EGFPAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SL542
Plasmid#49951PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
SL544
Plasmid#49970PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL545
Plasmid#49953PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL543
Plasmid#49952PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only