We narrowed to 24,475 results for: crispr
-
Plasmid#209447Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the kasOP* promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from kasOP* promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Thy-1-CRISPR-gRNA#1-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124283PurposesgRNA against human Thy-1DepositorInsertHomo sapiens Thy-1 cell surface antigen (THY1), transcript variant 1 (THY1 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Thy-1-CRISPR-gRNA#3-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124285PurposesgRNA against human Thy-1DepositorInsertHomo sapiens Thy-1 cell surface antigen (THY1), transcript variant 1 (THY1 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Thy-1-CRISPR-gRNA#2-(pSpCas9(BB)-2A-Puro (PX459) V2.0)
Plasmid#124284PurposesgRNA against human Thy-1DepositorInsertHomo sapiens Thy-1 cell surface antigen (THY1), transcript variant 1 (THY1 Human)
UseCRISPRAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEffector-LaTranC-CRISPR RNA
Plasmid#246928Purposefor E.coli plasmid interference and PAM depletion assaysDepositorInsertLaTranC
UseUnspecifiedAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/GFP-SCAF4 (CRISPR_resistant)
Plasmid#122471PurposeDox-inducible GFP (N-terminal tag) SCAF4 expressionDepositorInsertSCAF4 (SCAF4 Human)
TagsGFPExpressionMammalianMutationSynonymous mutations conferring resistance to gRN…PromoterCMVAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/GFP-SCAF8 (CRISPR_resistant)
Plasmid#122472PurposeDox-inducible GFP (N-terminal tag) SCAF8 expressionDepositorInsertSCAF8 (SCAF8 Human)
TagsGFPExpressionMammalianMutationSynonymous mutations conferring resistance to gRN…PromoterCMVAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-PE SpG
Plasmid#179081PurposeNOTE: An improved version of this plasmid is now available. See Addgene plasmid #242072. All-in-one prime editor piggyBac transposon, SpG variantDepositorInsertSpCas9 SpG_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationD1135L, S1136W, G1218K, E1219Q, R1335Q, T1337RPromoterCAGAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS2: pHelper(AvCAST)_AvPSP1_ΔTniQ
Plasmid#168134PurposeInducible expression of AvCAST proteins (except TniQ) with crRNA targeting AvPSP1.DepositorInsertsAvCAST minimal CRISPR array (with spacer for AvPSP1)
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB and TnsC)
AvTnsD
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDCX_mEmerald_CRISPR_HDR
Plasmid#239331PurposeHDR template to insert mEmerald before the stop codon in exon 7 of the human doublecortin (DCX) locusDepositorInsertmEmerald and DCX homology arms
UseCRISPRPromoterNoneAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DPB
Plasmid#164989PurposeExpression of gRNA targeting HLA-DPB locus, including DPB1*01:01:01DepositorInsertgRNA against HLA-DPB1*01:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DQB
Plasmid#164991PurposeExpression of gRNA targeting HLA-DQB locus, including DQB1*05:01:01DepositorInsertgRNA against HLA-DQB1*05:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DRB
Plasmid#164992PurposeExpression of gRNA targeting HLA-DRB locus, including DRB1*01:02:01DepositorInsertgRNA against HLA-DRB1*01:02:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DQA
Plasmid#164990PurposeExpression of gRNA targeting HLA-DQA locus, including DQA1*01:01:01DepositorInsertgRNA against HLA-DQA1*01:01:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DPA
Plasmid#164988PurposeExpression of gRNA targeting HLA-DPA locus, including DPA1*02:01:08DepositorInsertgRNA against HLA-DPA1*02:01:08
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_COX4
Plasmid#177983Purposelentiviral vector expressing Cas9 and a sgRNA targeting COX4DepositorInsertsgRNA targeting COX4
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
p8270 LentiCRISPR v2 hygro sgSIGIRR-3
Plasmid#193979PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8271 LentiCRISPR v2 hygro sgSIGIRR-4
Plasmid#193980PurposeExpression of spCas9 and sgRNA targeting SIGIRRDepositorInsertspCas9 and sgRNA targeting SIGIRR (SIGIRR Human)
UseLentiviralAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only