We narrowed to 4,207 results for: biorxiv
-
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSJX024
Plasmid#232327PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and catExpressionBacterialMutationPromoterPJ23119 and PxylAvailable sinceJune 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJX016
Plasmid#232324PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and sfGFPExpressionBacterialMutationPromoterPJ23119 and PvanAvailable sinceJune 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_P-linker 4E
Plasmid#234564PurposeCTNNA1 Phospholinker phospho-mimicDepositorInsertmEGFP:hCTNNA1_P-linker 4E (CTNNA1 Human)
UseLentiviralTagsmEGFPExpressionMutationS641E, S652E, S655E, T658EPromoterCMVAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_P-linker 4A
Plasmid#234563PurposeCTNNA1 Phospholinker phospho-mutantDepositorInsertmEGFP:hCTNNA1_P-linker 4A (CTNNA1 Human)
UseLentiviralTagsmEGFPExpressionMutationS641A, S652A, S655A, T658APromoterCMVAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_E307K
Plasmid#234560PurposeCTNNA1 butterfly eye mutantDepositorInsertmEGFP:hCTNNA1_E307K (CTNNA1 Human)
UseLentiviralTagsmEGFPExpressionMutationE307KPromoterCMVAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_L436P
Plasmid#234559PurposeCTNNA1 eye phenotype via forward genetic screenDepositorInsertmEGFP:hCTNNA1_L436P (CTNNA1 Human)
UseLentiviralTagsmEGFPExpressionMutationL436PPromoterCMVAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_R551A
Plasmid#234558PurposeCTNNA1 M2-M3 salt-bridge disrupting mutantDepositorInsertmEGFP:hCTNNA1_R551A (CTNNA1 Human)
UseLentiviralTagsmEGFPExpressionMutationR551APromoterCMVAvailable sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DNii domain
Plasmid#234557PurposeCTNNA1 Nii-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DNii domain (CTNNA1 Human)
UseLentiviralTagsmEGFPExpressionMutationDeletion of aa ~165-265PromoterCMVAvailable sinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM2,3-domain
Plasmid#234556PurposeCTNNA1 M2,3-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DM2,3-domain (CTNNA1 Human)
UseLentiviralTagsmEGFPExpressionMutationDeletion of aa 397-509PromoterCMVAvailable sinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-domain
Plasmid#234555PurposeCTNNA1 M1-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DM1-domain (CTNNA1 Human)
UseLentiviralTagsmEGFPExpressionMutationDeletion of aa 271-396PromoterCMVAvailable sinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA377 - pBA904 Puro-T2A-GFP CD55 CRISPRa guide 1 (pRCA360 backbone)
Plasmid#238168PurposeLentiviral CRISPR guide vector expressing CD55 targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertCD55 sgRNA CRISPRa (CD55 Human, Synthetic)
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA805 - pBA904 Puro-T2A-GFP KLF4 g1 CRISPRa guide (pRCA360 backbone) 668
Plasmid#238174PurposeLentiviral CRISPR guide vector expressing a KLF4 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertKLF4 sgRNA CRISPRa (KLF4 Human, Synthetic)
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA803 - pBA904 Puro-T2A-GFP KLF5 g1 CRISPRa guide (pRCA360 backbone) 666
Plasmid#238172PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertKLF5 sgRNA CRISPRa (KLF5 Human, Synthetic)
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA804 - pBA904 Puro-T2A-GFP KLF5 g2 CRISPRa guide (pRCA360 backbone) 665
Plasmid#238173PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertKLF5 sgRNA CRISPRa (KLF5 Human, Synthetic)
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA810 - pBA904 Puro-T2A-GFP HES7 g2 CRISPRa guide (pRCA360 backbone) 674
Plasmid#238177PurposeLentiviral CRISPR guide vector expressing a HES7 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertHES7 sgRNA CRISPRa (HES7 Human, Synthetic)
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA378 - pBA904 Puro-T2A-GFP CD45 CRISPRa guide 3 (pRCA360 backbone)
Plasmid#238169PurposeLentiviral CRISPR guide vector expressing PTPRC targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertCD45 sgRNA CRISPRa (PTPRC Human, Synthetic)
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA895 - pBA904 Puro-T2A-BFP KLF4 g1 CRISPRa guide guide (pRCA594 backbone) 668
Plasmid#238187PurposeLentiviral CRISPR guide vector expressing a KLF4 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertKLF4 sgRNA CRISPRa (KLF4 Human, Synthetic)
UseCRISPR and LentiviralTagsmTagBFP2ExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN nls-BFP-FLAG-WPRE-bgh-pA (JDW 452)
Plasmid#229827PurposeA CAGGS driven nls BFP with a FLAG tag followed by a WPRE-bGH polyA for stable transcriptsDepositorInsert3xnls-TagBFP2-MCS-FLAG
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ECS-dSpyCatcher003
Plasmid#234963PurposeCre-dependent ECS-facing destabilized SpyCatcher003 (facing the extracellular space)DepositorInsertECS-dSC
UseAAV and Cre/LoxTagsExpressionMammalianMutationNonePromoterAvailable sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only