We narrowed to 3,822 results for: biorxiv
-
Plasmid#224830PurposeEmpty Gateway DEST vector for expressing C-terminal tagged proteins with mKusabiraOrangekand hygromycin selection in plantsDepositorTypeEmpty backboneTagsmKusabiraOrangekExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only
-
PTPN20CP_pGCS1
Plasmid#238500PurposeIVT mRNA of human geneDepositorInsertPTPN20CP (PTPN20CP Human)
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
SRGAP2C_pEF-DEST51
Plasmid#238497PurposeIVT mRNA of human geneDepositorInsertSRGAP2C (SRGAP2C Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
PDZK1P1_pGCS1
Plasmid#238501PurposeIVT mRNA of human geneDepositorInsertPDZK1P1 (PDZK1P1 Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
ARHGAP11B_pEF-DEST51
Plasmid#238498PurposeIVT mRNA of human geneDepositorInsertARHGAP11B (ARHGAP11B Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
GPR89B_full_pGCS1
Plasmid#238499PurposeIVT mRNA of human geneDepositorInsertGPR89B (GPR89B Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD allW D262V
Plasmid#234616PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262V with all aromatic amino acids mutated to W keeping the hexapeptide fibril core (SYNDFG) intact.DepositorInserthnRNPA1_LCD_allW D262V (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) bearing familial ALS …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD allW
Plasmid#234609PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with all aromatic amino acids mutated to W keeping the hexapeptide fibril core (SYNDFG) intact.DepositorInserthnRNPA1_LCD_allW (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) with all aromatic ami…PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD allW D262N
Plasmid#234615PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262N with all aromatic amino acids mutated to W keeping the hexapeptide fibril core (SYNDFG) intact.DepositorInserthnRNPA1_LCD_allW D262N (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) bearing familial ALS …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUMN105
Plasmid#233024PurposeEncodes eGFP for ORBIT integration. High copy number.DepositorTypeEmpty backboneAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA1_allW_D262V-FLAG-IRES-eGFP
Plasmid#234621PurposeMammalian expression of full-length hnRNPA1 D262V with all aromatic amino acids in the C-terminal LCD mutated to W keeping the hexapeptide fibril core (SYNDFG) and the PY-NLS intact.DepositorInserthnRNPA1 allW D262V (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationFamillial ALS mutation D262V, all aromatic amino …PromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
FAM177A1-Halo
Plasmid#224591PurposeFor expression of FAM177A1-Halo in mammalian cellsDepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCEFL-HAx2-TEADiv2
Plasmid#228873PurposeExpression of optimized TEAD inhibitor (TEADiv2): 2xHA-tagged inhibitor of the interaction of YAP1 and TAZ with TEAD transcription factors with nuclear localization signalDepositorInsertTEADiv2
Tags2xHAExpressionMammalianAvailable SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
ZFPL1-GFP
Plasmid#224590PurposeFor expression of ZFPL1-GFP in mammalian cellsDepositorAvailable SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
FAM177A1-SNAP
Plasmid#224592PurposeFor expression of FAM177A1-SNAPTag in mammalian cellsDepositorAvailable SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-MCS-3AID-HA-2A-mTurquoiseBSD
Plasmid#225704PurposeEmpty backbone for lentiviral expression of AID degron tagged POI and mTurquoise fused BlasticidinRDepositorTypeEmpty backboneUseLentiviral and Synthetic BiologyTagsT2A-mTurquoiseExpressionMammalianPromoterpEF1AAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-DNMT3Bcd-2A-mTurquoise
Plasmid#225693PurposeLentiviral expression of rTetR(SE) fused to the catalytic domain of DNMT3B and mTurquoise-NLSDepositorInsertrTetR-DNMT3B catalytic domain (DNMT3B Synthetic, Human)
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
1114H
Plasmid#200640PurposeAn. gambiae transgenesis plasmid. Expresses gRNAs targeting B2-tubulin, ZPG, and DSXF. Crossing to Cas9 generates sterile malesDepositorInsertgRNA targeting DSXF, ZPG, and B2-tubulin. Actin5c-CFP and Vasa2-EYFP reporters.
UseCRISPRExpressionInsectAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
OA-1067L
Plasmid#200253PurposepBac-U6-gRNA(doublesex+Intersex+bTublin)-3xp3-tdTomatoDepositorInsert6 gRNAs targeting Doublesex, Intersex, bTublin
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only