We narrowed to 24,275 results for: CHI
-
Plasmid#216673PurposeExpresses hisMBP-tagged rat oxidation-resistant RNase inhibitor in E. coli hostsDepositorAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pDOXOFF (STOP)99xGly
Plasmid#211349PurposeDOX-regulated lentiviral expression of 99xGly-EGFP-3xHA lacking initiation codonDepositorInsert(STOP)99xGly-EGFP-3xHA
UseLentiviralTagsEGFP-3xHAMutationStart (ATG) codon replaced with stop (TAG) codonAvailable SinceOct. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-JeT-pmRevErbA-miRFP713-NLS-Pest
Plasmid#240110PurposeA lentiviral (infrared) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by synthtic JeT promoter.DepositorInsertmurine Nr1d1 promoter+miRFP713-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded JeT PromoterAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-DEST40-SIRT1
Plasmid#242124PurposeExpression in mammalian cellsDepositorAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5R DD-FAM98B
Plasmid#211357PurposeTransient expression of DD-V5-FAM98BDepositorAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(3)-pmRevErbA-Venus-NLS-Pest
Plasmid#240114PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter fragment.DepositorInsertmurine Nr1d1 promoter+Venus-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-EnhancerAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(4)-pmRevErbA-Venus-NLS-Pest
Plasmid#240115PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter.DepositorInsertmurine Nr1d1 promoter+Venus-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-Enhancer+OriAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(2)-pmRevErbA-Venus-NLS-Pest
Plasmid#240113PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter.DepositorInsertmurine Nr1d1 promoter+Venus-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-Enhancer+OriAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(3)-pmRevErbA-mScaI3-NLS-Pest
Plasmid#240117PurposeA lentiviral (red) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter fragment.DepositorInsertmurine Nr1d1 promoter+mScarlet-I3-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-EnhancerAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-JeT-pmRevErbA-mClover3-NLS-Pest
Plasmid#240109PurposeA lentiviral (yellow-green) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by synthtic JeT promoter.DepositorInsertmurine Nr1d1 promoter+mClover3-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded JeT PromoterAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-Rac1(dog)
Plasmid#228760PurposeA knockdown vector for dog Rac1.DepositorInsertA shRNA targeting the dog Rac1 gene (RAC1 canis lupus)
ExpressionMammalianAvailable SinceJuly 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET30a-SSDH
Plasmid#239573PurposeExpresses E. coli succinate semialdehyde dehydrogenase (SSDH/gabD) for recombinant protein purification. Contains a His6-tag on its C-terminus for Ni2+ affinity chromatography.DepositorAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Twin-strep-TEV-DGKδ2-DSAMD
Plasmid#223721PurposeExpress human diacylglycerol kinase delta 2- SAM domain deletion mutant (N-terminal TEV protease cleavable Twin-Strep-fusion protein) in mammalian cellDepositorInsertDGKD (DGKD Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted sterile alpha motif domain (deleted amino…PromoterCAG and chicken β-actin promoterAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP-SL01V6
Plasmid#218249Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL01V6 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP-SL01V9
Plasmid#218250Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL01V9 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP-SL08V9
Plasmid#218251Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL08V9 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-CMV-MAAP-SL01
Plasmid#218248Purpose1) Ectopic expression of MAAP protein variant in mammalian cells. 2) Packaging MAAP variant sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein Variant SL01 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd
Plasmid#216170PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
Plasmid#216172PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- Control- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG-sgRNA.FOXA-ZEB2_CRISPRd_v2
Plasmid#216173PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-tac-EcTyrRS-VSMA*-lpp-tRNA_CUA^EcTyr
Plasmid#218766Purposeencodes EcTyrRS-VSMA* and EcTyr-tRNA-TAGDepositorInsertEcTyrRS-VSMA*
ExpressionBacterialMutationY37V, D167G, D182S, F183M, L186A, D265RPromotertacIAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTY186 EGFP-T2A-ALFA-ORF6 SARS-CoV-2
Plasmid#204976PurposeCo-express EGFP and SARS-CoV-2 ORF6 N-terminally labeled with ALFA tagDepositorAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnTS-E1015A
Plasmid#213415PurposeVinculin tension sensor (VcnTS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1015A).DepositorInsertVcnTS-E1015A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1015 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnTS-E1021A
Plasmid#213416PurposeVinculin tension sensor (VcnTS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1021A).DepositorInsertVcnTS-E1021A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1021 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnCS-E1015A
Plasmid#213412PurposeVinculin conformation sensor (VcnCS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1015A).DepositorInsertVcnCS-E1015A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1015 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-VcnCS-E1021A
Plasmid#213413PurposeVinculin conformation sensor (VcnCS) with a single directionally asymmetric, force strengthening (DAFS) variant point mutation (E1021A).DepositorInsertVcnCS-E1021A (VCL Chicken, Synthetic)
ExpressionMammalianMutationMutated vinculin glutamic acid 1021 to alanine (E…PromoterCMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLINE1ΔORF2-scFvFc
Plasmid#206021PurposeThe ORF2 sequence was removed from pLINE1-scFvFcDepositorInsertmouse LINE1 vector harboring an scFv-Fc expression unit, lacking the ORF2 sequence
ExpressionMammalianAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLINE1ΔORF1-2-scFvFc
Plasmid#206022PurposeThe ORF1 and ORF2 sequences were removed from pLINE1-scFvFcDepositorInsertmouse LINE1 vector harboring an scFv-Fc expression unit, lacking the ORF1 and ORF2 sequences
ExpressionMammalianAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only