We narrowed to 13,078 results for: CAR
-
Plasmid#51931Purposemammalian expression of dominant negative JNK2DepositorInsertDN JNK2 (Mapk9 Mouse)
TagsHAExpressionMammalianMutationdominant negative: the dual phosphorylation moti…Promotercardiac-specific α-myosin heavy chain 5.5 kb pro…Available SinceJune 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-PALMDgRNA1+2-cTnT-Cre -mi122TS
Plasmid#216830Purposecardiomyocytes-specific plasmid, expressing gRNAs targeting Palmd exon7, containing a mi122TS sequence to decrease off-target effects in the liver.DepositorInsertPALMDgRNA
UseAAVAvailable SinceAug. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-Necl-5-ScNeo
Plasmid#170283PurposeTo monitor the status of Necl-5, the plasmid encodes a recombinant Necl-5 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInserta recombinant mouse Necl-5 fused to the mScarlet and to the mNeonGreen fluorescent protein (Pvr Synthetic, Mouse)
TagsmScarlet and mNeonGreenExpressionMammalianAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
His-ZZ-TEV-BICDR1-GFP
Plasmid#111657PurposeC-terminal GFP tag on BICDR1 for expression in Sf9 cells. 8xHis-ZZ-GFP N-terminal tag, TEV site to cleave 8xHis-ZZ.DepositorInsertBICDR1-GFP (Bicdl1 Mouse)
Tags8xHis-tag, GFP, TEV site, and ZZExpressionInsectMutationOptimised for Sf9 expressionAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmx-MiGT
Plasmid#172397PurposeRetroviral expression vector for murine direct cardiac reprogrammingDepositorAvailable SinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-dDIO-lck-smMyc-4x6T
Plasmid#196421PurposeDre-dependent AAV expression of membrane-targeted Myc spaghetti monster reporter preferentially in astrocytes; astrocyte selectivity generated with 4x6T miRNA targeting cassetteDepositorInsertLck-smMyc
UseAAV; Dre/rox; astrocyte-selectiveTagsLckExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTER GAMMA-TUBULIN shRNA Human
Plasmid#87955Purposereduced the expression of gamma-tubulin in human cellsDepositorInsertsh gamma-tubulin (TUBG1 Human)
TagsNo-tagExpressionMammalianMutationThe protein is a sh-gamma-tubulin resistant gene.…Available SinceOct. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
His-ZZ-TEV-BICDN(1-400)-GFP
Plasmid#111862PurposeC-terminal GFP tag on BICDN (amino acids 1-400) for baculovirus expression in Sf9 cells. 8xHis-ZZ N-terminal tag, TEV site to cleave 8xHis-ZZ.DepositorInsertBICDN(1-400)-GFP (Bicd2 Mouse)
Tags8xHis tag, GFP, and ZZ tagExpressionInsectMutationCodon optimized for Sf9 expressionAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hook3(1-522)-SNAPf-Psc-StrepII
Plasmid#111860PurposeC-terminal SNAPf tag on Hook3 (amino acids 1-522) for expression in Sf9 cells. C-terminal SNAPf-Psc-StrepII tag.DepositorInsertHook3(1-552)-SNAPf (HOOK3 Human)
TagsPsc, SNAPf, and Strep-IIExpressionInsectMutationOptimised for expression in Sf9 cellsAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Hook3(1-522)-GFP-Psc-StrepII
Plasmid#111861PurposeC-terminal GFP tag on Hook3 (amino acids 1-522) for expression in Sf9 cells. C-terminal GFP-Psc-StrepII tag.DepositorInsertHook3(1-552)-GFP (HOOK3 Human)
TagsGFP, Psc tag, and Strep tagExpressionInsectMutationOptimised for expression in SF9 cellsAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1-human LIC1 G domain
Plasmid#74598Purposeused for expression in E. coli and purification. N-terminal GST tag and C-terminal Strep tag, aa 1-389DepositorInserthuman dynein light intermediate chain 1 amino acids 1-389 (DYNC1LI1 Human)
TagsN-terminal GST and Strep IIExpressionBacterialPromoterT7Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.BRWD3-V5H
Plasmid#48624PurposeExpresses Drosophila BRWD3 (with V5 and His tags at the C-terminus) in mammalian cellsDepositorInsertBRWD3 (BRWD3 Fly)
TagsV5 and His tagsExpressionMammalianMutationno mutations, stop was removed to fuse V5His at C…PromoterCMVAvailable SinceOct. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFRT-B-GRPA
Plasmid#226222PurposeHuman RPA34 tagged to GFP under a EF1alpha promotor for generating stable HeLa Kyoto GFP-RPA34 using the Flp-In recombination systemDepositorAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENPT-McHFD-GFP
Plasmid#237437PurposeExpresses Mus musculus CENP-T with Mus caroli HFD; tagged with GFP at C-term; made for in vitro transcription (T7 promoter)DepositorInsertMus musculus CENP-T with Mus caroli HFD (Cenpt Mouse)
TagsGFPExpressionMammalianMutationHFD (residues 413-503) swapped from Mus caroliPromoterT7Available SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AtmiR173aTS-B/c
Plasmid#227964PurposeEntry plasmid with AtmiR173aTS and a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertsB/c
AtmiR173aTS
PromoterNoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtmiR173aTS-B/c
Plasmid#227965PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Arabidopsis thaliana.DepositorInsertsB/c
AtmiR173aTS
ExpressionPlantPromoter35S and NoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-NbmiR482aTS-B/c
Plasmid#227966PurposeEntry plasmid with NbmiR482aTS and a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertsB/c
NbmiR482aTS
PromoterNoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-NbmiR482aTS-B/c
Plasmid#227967PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Nicotiana benthamiana.DepositorInsertsB/c
NbmiR482aTS
ExpressionPlantPromoter35S and NoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-LAP
Plasmid#222322PurposeSynchronize the trafficking of LAP from the ER.DepositorAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only