We narrowed to 8,836 results for: FIE
-
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_5UTR_Myc_FLuc RBM42 deletion
Plasmid#229503PurposeMyc 5' untranslated region firefly luciferase reporter with deletion of region bound by RBM42.DepositorInsertMyc 5'UTR_Del 363
ExpressionMammalianMutationDeletion of bp 363-394PromoterSV40Available SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_5UTR_Myc_FLuc Compensatory Mutant
Plasmid#229504PurposeMyc 5' untranslated region firefly luciferase reporter with compensatory mutations in the region bound by RBM42DepositorInsertMyc 5'UTR_CompMutant
ExpressionMammalianMutationMutations in bp 363-394PromoterSV40Available SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eA3A-BE5-(NG)-PX458-EGFP
Plasmid#229687PurposeCRISPR CBE plasmid (C to T edits): eA3A-BE5-NG engineered to include the sgRNA cloning backbone from PX458 and EGFP. Includes BbsI sites for sgRNA cloning downstream of U6 promoter.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
FLAG-MKI-MUT-P2A-GFP
Plasmid#229406PurposeLentiviral or overpexression of cDNADepositorInsertMKI-MUT-P2A-GFP
UseLentiviralTagsFLAGExpressionMammalianMutationinteraction mutant L109G; L143G (Control mutant)PromoterEFSAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A empty
Plasmid#213164PurposeEmpty vector (no sgRNA) for induction of global DNA methylation.DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgGFP
Plasmid#213165PurposeVector with sgGFP for induction of global DNA methylation.DepositorInsertsgGFP
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6 and PGKAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgAAVS1_145
Plasmid#213166PurposeVector with sgAAVS1 for induction of global DNA methylation.DepositorInsertsgAAVS1_145
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgAAVS1_118
Plasmid#213167PurposeVector with sgAAVS1 for induction of global DNA methylation.DepositorInsertsgAAVS1_118
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A-inactiveEmpty
Plasmid#213168PurposeEmpty Vector (no sgRNA) used as a negative control (inactive DNMT3A) for induction of global DNA methylation.DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest-pol2-Smarcd1-Myc
Plasmid#227716PurposeExpresses mouse Smarcd1 protein with a Myc tag from a Pol2 promoter. Has a Blasticidin resistance gene for stable cell line generation and Ampicilin for plasmid propagation.DepositorAvailable SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGGI_Myr-YFP-MiniTurboID
Plasmid#222432PurposePotential plasma membrane control.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker, Myr, and YFPMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PrP (1-22)-BioID2-HA-13 x Linker- RBP(V)-GPI-PSS
Plasmid#194753PurposeLentiviral expression of BioID2-HA-13 x Linker- RBP(V) on the cell surface via a GPI anchorDepositorInsertPrP (1-22)-BioID2-HA-13 x Linker- RBP(V)-GPI-PSS
UseLentiviralTagsHAPromoterCMVAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PrP (1-22)-RBP(V)-13 x Linker-BioID2-HA-GPI-PSS
Plasmid#194752PurposeLentiviral expression of RBP(V)-13 x Linker-BioID2-HA on the cell surface via a GPI anchorDepositorInsertPrP (1-22)-RBP(V)-13 x Linker-BioID2-HA-GPI-PSS
UseLentiviralTagsHAPromoterCMVAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS1983 Lenti-dead_GFP_ABE reporter-BlastR
Plasmid#211820PurposeLentiviral vector expressing a dead GFP adenine base editing reporterDepositorInsertdead GFP reporter
UseLentiviralExpressionMammalianPromoterCMV promoter and SV40 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ08-pAAVsc.U6-tracrRNA
Plasmid#211816PurposeAAV vector expressing tracrRNA under U6 promoterDepositorInsertU6-tracrRNA
UseAAVExpressionMammalianPromoterU6Available SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS7 puro
Plasmid#208405PurposeExpresses FLAG-tagged Drosophila IntS7 from inducible MtnA promoterDepositorAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only