We narrowed to 9,265 results for: yeast expression
-
Plasmid#17435DepositorInsertGALS promoter + polylinker + CYC1 terminator (GAL1 Budding Yeast)
UseTagsExpressionBacterial and YeastMutationGALS promoter is between SacI and XbaI restrictio…PromoterAvailable SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
pRS414-7x2-PHO5-GFP-hPLC delta PH domain dimer
Plasmid#58837PurposeExpresses GFP-Tagged Human PLC delta PH domain in yeastDepositorInsert2x Phospolipase C delta1 PH domain (Plcd1 Rat)
UseTagsGFPExpressionYeastMutationPromoterPHO5Available SinceSept. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CUP1-1
Plasmid#166086PurposePlasmid for constituive spCas9 and tet-inducible CUP1-1 targeting sgRNA expression for double stranded break formation in yeastDepositorInsertCUP1-1 (CUP1-1 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTH340-SUP45(1-242)-GalBD
Plasmid#29740DepositorInsertSUP45 (SUP45 Budding Yeast)
UseTagsGal Activation domain and MycExpressionYeastMutationCodons 1-242 of the yeast SUP45 gene onlyPromoterAvailable SinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
Sc FLAG-S6-RFC1-pRS405/GAL-L
Plasmid#239473PurposeOverexpress Sc FLAG-S6-RFC1 in yeast (integrated)DepositorInsertSc FLAG-S6-RFC1 (RFC1 Budding Yeast)
UseTags3X FLAG followed by S6ExpressionYeastMutationPromoterAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc [Pol31 + Pol32]-pRS403/GAL
Plasmid#239199PurposeOvererxpress Sc Pol31 & Pol32 when integrated into yeast (S. cer)DepositorUseTagsExpressionYeastMutationPromoterAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
Peripherin/pAS2-1
Plasmid#98135PurposePeripherin (NM_006262) in DNA-binding domain (BD) vector, used for yeast-two hybridDepositorAvailable SinceAug. 21, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTH341-SUP45(139-437)-GalBD
Plasmid#29741DepositorInsertSUP45 (SUP45 Budding Yeast)
UseTagsGal Activation domain and MycExpressionYeastMutationCodons 139-437 of the yeast SUP45 gene onlyPromoterAvailable SinceSept. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH339-SUP45(1-138)-GalBD
Plasmid#29739DepositorInsertSUP45 (SUP45 Budding Yeast)
UseTagsGal Activation domain and MycExpressionYeastMutationCodons 1-138 of the yeast SUP45 gene onlyPromoterAvailable SinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH342-SUP45(276-437)-GalBD
Plasmid#29742DepositorInsertSUP45 (SUP45 Budding Yeast)
UseTagsGal Activation domain and MycExpressionYeastMutationCodons 276-437 of the yeast SUP45 gene onlyPromoterAvailable SinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL39
Plasmid#166078PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL39 for double stranded break formation in yeast.DepositorInsertPromoter of RPL39 (Overlaps with 5'UTR and first base of gene) (RPL39 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only