We narrowed to 2,182 results for: Xpa
-
Plasmid#231325PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. L1-RSF1010-Tc-par-ELT4; GG assembly from pOGG004, pOGG042, pNDGG005, pOGG012, and pOGG014, TcRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only
-
SRGAP2C_pEF-DEST51
Plasmid#238497PurposeIVT mRNA of human geneDepositorInsertSRGAP2C (SRGAP2C Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
PDZK1P1_pGCS1
Plasmid#238501PurposeIVT mRNA of human geneDepositorInsertPDZK1P1 (PDZK1P1 Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
ARHGAP11B_pEF-DEST51
Plasmid#238498PurposeIVT mRNA of human geneDepositorInsertARHGAP11B (ARHGAP11B Human)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG012
Plasmid#231333PurposeBEVA Golden Gate cloning vector; Narrow host range plasmid with FRT site. L1-pMB1-Gm-FRT-ELT4; GG assembly from pNDGG021, pOGG009, pNDGG007, pNDGG009, pOGG014. GmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQGG005
Plasmid#231332PurposeBEVA Golden Gate cloning vector; BEVA2.0 Narrow host range plasmid with I-SceI-ELT4 counterselectable site for BpiI cloning. L2-P15A-Gm-ISceI-ELT4; GG assembly from pOGG006, pOGG009, pNDGG006, pGQ0023, pOGG014. GmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQGG004
Plasmid#231331PurposeBEVA Golden Gate cloning vector; BEVA2.0 Narrow host range plasmid with I-SceI counterselectable site. L1-P15A-Gm-ISceI-ELT4; GG assembly from pOGG004, pOGG009, pNDGG006, pGQ0023, pOGG014. GmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG058
Plasmid#231326PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. L1-RSF1010-Sp-par-ELT4; GG assembly from pGQ0015, pNDGG002, pNDGG005, pOGG012, and pOGG014, SpRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG056
Plasmid#231324PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. L1-RSF1010-Gm-par-ELT4; GG assembly from pGQ0015, pOGG009, pNDGG005, pOGG012, and pOGG014, GmRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG070
Plasmid#231328PurposeBEVA Golden Gate cloning vector; BEVA2.0 Sucrose curable broad host range plasmid . L1-pBBR1-Sp-sacB-ELT4; GG assembly from pOGG004, pNDGG002, pOGG011, pNDGG008, and pOGG014, SpRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG049
Plasmid#231318PurposeBEVA Golden Gate cloning vector; BEVA2.0 Broad host range plasmid with stability. -pBBR1-Gm-par-ELT4; GG assembly from pOGG004, pOGG009, pOGG011, pOGG012, and pOGG014, GmRDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG021
Plasmid#231305PurposeVector part for BEVA; BEVA2.0 Position 1 Level 1 BsaI cloning site without T0, AmpRDepositorInsertBEVA2.0 Position 1 Level 1 BsaI cloning site without T0, AmpR
ExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG008
Plasmid#231312PurposeVector part for BEVA; BEVA2.0 Position 4 sacB sucrose counterselection module, AmpR.DepositorInsertBEVA2.0 Position 4 sacB sucrose counterselection module, AmpR.
ExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQGG002
Plasmid#231329PurposeBEVA Golden Gate cloning vector; BEVA2.0 Narrow host range plasmid with I-SceI counterselectable site. L1-P15A-Nm-ISceI; GG assembly from pOGG004, pNDGG001, pNDGG006, pGQ0023, pOGG014. KmR/NmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*Y152*
Plasmid#191112PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134 & 152DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 & Y152 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK468 (BSD-P2A-mAID-dTAG)
Plasmid#214394PurposemAID-dTAG for N-terminal taggingDepositorInsertBSD-P2A-mAID-dTAG
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK452 (BSD-P2A-dTAG-mClover)
Plasmid#214382PurposedTAG-mClover for N-terminal taggingDepositorInsertBSD-P2A-dTAG-mClover
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.1
Plasmid#208306PurposeExpresses ABE-RA4.1 in mammalian cellsDepositorInsertTadA-RA4.1-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.3
Plasmid#208308PurposeExpresses ABE-RA4.3 in mammalian cellsDepositorInsertTadA-RA4.3-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.4
Plasmid#208309PurposeExpresses ABE-RA4.4in mammalian cellsDepositorInsertTadA-RA4.4-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.5
Plasmid#208310PurposeExpresses ABE-RA4.5 in mammalian cellsDepositorInsertTadA-RA4.5-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA4.6
Plasmid#208311PurposeExpresses ABE-RA4.6 in mammalian cellsDepositorInsertTadA-RA4.6-SpCas9 D10A
ExpressionMammalianMutationP48A, R51H, I76F, A106V, D108G, K110R, T111H, D11…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.0
Plasmid#208312PurposeExpresses ABE-RA5.0 in mammalian cellsDepositorInsertTadA-RA5.0-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76F, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.1
Plasmid#208313PurposeExpresses ABE-RA5.1 in mammalian cellsDepositorInsertTadA-RA5.1-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76F, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.3
Plasmid#208314PurposeExpresses ABE-RA5.3 in mammalian cellsDepositorInsertTadA-RA5.3-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76F, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.4
Plasmid#208315PurposeExpresses ABE-RA5.4 in mammalian cellsDepositorInsertTadA-RA5.4-SpCas9 D10A
ExpressionMammalianMutationW23R, R47K, P48A, R51L, I76Y, V82S, A106V, D108G,…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE-RA5.6
Plasmid#208317PurposeExpresses ABE-RA5.6 in mammalian cellsDepositorInsertTadA-RA5.6-SpCas9 D10A
ExpressionMammalianMutationW23R, H36L, R47K, P48A, R51L, I76Y, V82S, A106V, …Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
FB395
Plasmid#203631PurposeTU for the expression of luciferase under a synthetic promoter containing the target sequence for gRNA1 (1xLuc).DepositorInsertR1:G1aG2b.1:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB396
Plasmid#203632PurposeTU for the expression of luciferase under a synthetic promoter containing two copies of the target sequence for gRNA1 (2xLuc).DepositorInsertR1:G1ab.1:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB397
Plasmid#203633PurposeTU for the expression of luciferase under a synthetic promoter containing three copies of the target sequence for gRNA1 (3xLuc).DepositorInsertR1:G1abc.3:mPAF:Luc:TtrpC
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB312
Plasmid#203569PurposeTU for the expression of Nanoluciferase (Nluc) under the PgpdA promoter.DepositorInsertPgpdA:Nluc:Ttub
UseSynthetic BiologyAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ4
Plasmid#198176PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-4 μ4 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-4 μ4
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceApril 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ2
Plasmid#198173PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-2 μ2 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-2 μ2
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL359
Plasmid#168420PurposepGBKT7 yeast two-hybrid plasmidDepositorInsertOsaHIP41
ExpressionYeastAvailable SinceNov. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCK411.RR1
Plasmid#192644PurposeExpresses sgRNA RR1 (target mRFP CDS) on ColE1-AmpRDepositorInsertBBa_J23119-RR1
UseCRISPR and Synthetic BiologyPromoterBBa_J23119Available SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAV103-PRNR2-mCherry-Elk1DM-1SIM
Plasmid#190252PurposeExpression mCherry-Elk1DM in yeast cellsDepositorInsertELK1DM-SIM
TagsmCherryExpressionYeastAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAV105-PPAB1-GFP-Erk1R84S-1SIM
Plasmid#190253PurposeExpression Erk1-GFP-1SIM in yeast cellsDepositorInsertERK1R84S-SIM
TagsGFPExpressionYeastMutationERK1R84SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4D42
Plasmid#185840PurposeTesting the TEF1 promoter inserted with 4 Z268 elements using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1+[Z268]>yEGFP>TPGK1-TURA3
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only