We narrowed to 7,550 results for: aav
-
Plasmid#129476PurposeAAV2 transfer plasmid for truncated C3 with EGFP under control of the CBA promoterDepositorInserttruncated (AA173-201) exoenzyme C3 from C. botulinum, P2A, EGFP
UseAAVExpressionMammalianPromoterCBAAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4a
Plasmid#194973PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4a) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4d
Plasmid#194975PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4d) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_P1
Plasmid#194972PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4c
Plasmid#194974PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4c) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOttc1494 - pAAV CaMKII SERCaMP-No Tag
Plasmid#192601PurposeAn AAV packaging vector that expresses SERCaMP under control of the CaMKII promoter.DepositorInsertSERCaMP
UseAAVPromoterCaMKIIAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV2/9-shMBVR-HO1-Fd-Fnr-CW3SL
Plasmid#184003PurposeAAV productionDepositorInsertshMBVR-HO1-Fd-Fnr-CW3SL
UseAAVAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-dnVamp3-P2AT2A-EGFP-caax
Plasmid#190154PurposeExpresses dominant-negative Vamp3 (rat Vamp3 AA 1-81) plus membrane-targeted EGFP in oligodendrocytes; AAV vectorDepositorInsertVamp3 (Vamp2 Rat)
UseAAVTagsP2AT2A-EGFP-caaxExpressionMammalianMutationTruncation that includes only rat Vamp3 AA #1-81PromoterMBPAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-syn-LifeAct-jGCaMP8f-WPRE
Plasmid#186038PurposeAAV-mediated expression of LifeAct-jGCaMP8f under the synapsin promoterDepositorInsertLifeAct-jGCaMP8f
UseAAVTagsLifeAct-6xHisExpressionMammalianPromotersynapsinAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-syn-LifeAct-jGCaMP8s-WPRE
Plasmid#186040PurposeAAV-mediated expression of LifeAct-jGCaMP8s under the synapsin promoterDepositorInsertLifeAct-jGCaMP8s
UseAAVTagsLifeAct-6xHisExpressionMammalianPromotersynapsinAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-fDIO-tdTomato-WPRE
Plasmid#187112PurposeFLP-dependent expression of tdTomato under EF1a promoterDepositorInserttdTomato
UseAAVAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NLS-QPAS1-VP16
Plasmid#186187PurposeAAV vector packaging QPAS1-VP16, a component of optogenetic system for NIR light-controllable transcriptional activationDepositorInsertNLS-QPAS1-VP16
UseAAVPromoterCAGAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-mSNCA(1-95)
Plasmid#185716PurposeAAV expression of GFP and C-terminal truncated (1-95 amino acid) mouse α-Synuclein from hSyn promoterDepositorAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS3-TeTLc-P2A-mCherry
Plasmid#178708PurposeAAV vector for Flp-dependent transgene expression of TeTLc-P2A-mCherry in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertTeTLc-P2A-mCherry
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hsChRmine-oScarlet-WPRE
Plasmid#183520PurposeOptogeneticsDepositorInserthsChRmine-oScarlet
UseAAVMutationH33RPromoterCaMKIIaAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP224-AAV-Basic-0.4αCaMKII-GFP-pA
Plasmid#62909PurposeAAV basic vector backbone designed to express GFP from a 0.4CaMKIIa promoter. It also contains a poly-Adenylation Signal (pA).DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoter0.4αCaMKIIAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_HA-TALE(HD)-Tet1S-NLS-SID4X_2A_EGFP_W3SL
Plasmid#172208PurposeAAV vector expressing an HA-tagged TALE-SID4X transcriptional repressor protein targeting the mouse Tet1S promoter. Synapsin promoter for neuronal expression. C-terminal, self-cleaving EGFP marker.DepositorInsertHA-TALE(HD)-Tet1S-NLS-SID4X_2A_EGFP_W3SL
UseAAV and Mouse Targeting; TaleTagsHA, NLS, and T2A-EGFPExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_HA-TALE(NG)-Tet1FL-NLS-SID4X_2A_EGFP_W3SL
Plasmid#172205PurposeAAV vector expressing an HA-tagged TALE-SID4X transcriptional repressor protein targeting the mouse Tet1FL promoter. Synapsin promoter for neuronal expression. C-terminal, self-cleaving EGFP marker.DepositorInsertHA-TALE(NG)-Tet1FL-SID4X-NLS_2A_EGFP_W3SL
UseAAV and Mouse Targeting; TaleTagsHA, NLS, and T2A-EGFPExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only