We narrowed to 4,293 results for: 110
-
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9(BB)-2A-Neo_h53BP1_gRNA_D
Plasmid#110300PurposeExpresssion of Cas9-T2A-neomycin resistant gene and a gRNA targeting exon 10 of human 53BP1DepositorInsertp53-binding protein 1 (TP53BP1 Human)
ExpressionMammalianAvailable sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBTK107
Plasmid#110575PurposeBTK Type 2 promoter for golden gate assemblyDepositorInsertCP25 Promoter with RBS
UseSynthetic BiologyAvailable sinceFeb. 20, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBTK121
Plasmid#110581PurposeBTK Type 2 promoter for golden gate assemblyDepositorInsertPA3 Promoter with RBS
UseSynthetic BiologyAvailable sinceFeb. 20, 2020AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pBTK403
Plasmid#110599PurposeBTK Type 8 Bacterial origin (broad-host-range) for golden gate assemblyDepositorInsertmRFP dropout (RSF1010 origin)
UseSynthetic BiologyAvailable sinceFeb. 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBMN-mEGFP-C1
Plasmid#110468Purposeretrovirus construct for stable expressing mEGFP tagged proteinDepositorInsertmEGFP
UseRetroviral; RetrovirusTagsmEGFPExpressionMammalianAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGC4593
Plasmid#110206PurposeAccessory plasmid with inducible TEV protease and unnatural tRNA system (AcF)DepositorInsertsTEV protease
aaRS
ExpressionBacterialPromoterPbad and PtetAvailable sinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pblic-neo TRX1
Plasmid#110919PurposeTo overexpress Thioredoxin-1DepositorAvailable sinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shLuc
Plasmid#110409PurposeshLuc (Target TTACGCTGAGTACTTCGA), silence LUC gene, blasticidin selection.DepositorInsertLuciferase
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available sinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
E. coli 16S toehold switch sensor
Plasmid#110698PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertE. coli 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available sinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ubiquitin (1-76; T66V, L67N)
Plasmid#110755PurposeBacterial expression of human Ubiquitin (1-76; T66V, L67N)DepositorAvailable sinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQC V5 MCS IRES Puro
Plasmid#110342Purposeγ-Retroviral transfer vector for cloning and expressing your gene of interest. V5 N-Terminal tag, IRES-driven Puromycin selection.DepositorTypeEmpty backboneUseRetroviralTagsV5ExpressionMammalianPromoterCMVAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shGAC
Plasmid#110410PurposeshGAC (Target CCTCTGTTCTGTCAGAGTT), silence glutaminase isoform GAC, blasticidin selection.DepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBTK563
Plasmid#110612PurposeBTK assembled broad-host-range plasmid encoding NanoLuc luciferase protein driven by CP25 promoterDepositorInsertNanoluc
ExpressionBacterialAvailable sinceAug. 10, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
mCherry-PKCZdel239
Plasmid#110514PurposeConstitutive ActiveDepositorInsertPKCZ (PRKCZ Human)
TagsmCherryExpressionMammalianMutationDeleted amino terminal 239 amino acidsAvailable sinceJuly 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-P2A-Puro
Plasmid#110851PurposeLentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRP(Exp)-CMV> ORF_924bp (Azgp1):T2A:dTomato:IRES:Puro
Plasmid#110830PurposeExpresses zinc alpha-2 glycoprotein (ZAG) and dTomato (dT) reporter where both sequences are separated by a T2A self-cleaving peptide sequence as a result, the dT is not fused with the ZAG protein.DepositorAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Human RNF144B (27-236)
Plasmid#110753PurposeBacterial Expression of RNF144B RBR domainDepositorAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
plko-puromycin-shTRX1-259
Plasmid#110921PurposeTo knockdown Thioredoxin-1DepositorAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only