We narrowed to 533 results for: src
-
Plasmid#244492PurposeBacterial Expression of SHP2 mutantDepositorInsertPTPN11 (PTPN11 Human)
TagsGSTExpressionBacterialMutationchanged Histidine 116 to AlanineAvailable sinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1 SHP2 E252A
Plasmid#244491PurposeBacterial Expression of SHP2 mutantDepositorInsertPTPN11 (PTPN11 Human)
TagsGSTExpressionBacterialMutationchanged Glutamate 252 to AlanineAvailable sinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PM-deltaCKAR
Plasmid#222429PurposeFRET-based reporter for monitoring deltaPKC activity at the plasma membrane in cells.DepositorInsertPlasma membrane delta-selective C kinase activity reporter
TagsCFP and YFPExpressionMammalianAvailable sinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Nuc-deltaCKAR
Plasmid#222430PurposeFRET-based reporter for monitoring deltaPKC activity at the nucleus in cells.DepositorInsertNucleus delta-selective C kinase activity reporter
TagsCFP and YFPExpressionMammalianAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Mito(OM)-deltaCKAR
Plasmid#222431PurposeFRET-based reporter for monitoring deltaPKC activity at the mitochondrial outer membrane in cells.DepositorInsertMitochondrial outer membrane delta-selective C kinase activity reporter
TagsCFP and YFPExpressionMammalianAvailable sinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Golgi-deltaCKAR
Plasmid#222428PurposeFRET-based reporter for monitoring deltaPKC activity at the Golgi in cells.DepositorInsertGolgi delta-selective C kinase activity reporter
TagsCFP and YFPExpressionMammalianAvailable sinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta mouse
Plasmid#224577PurposeNegative Control for downregulation of the expression of human DGK zeta in human cellsDepositorAvailable sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa human
Plasmid#224578PurposeTo stably downregulate the expression of human DGK alfa in human cellsDepositorAvailable sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_R89A-PolyA
Plasmid#112291PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) R89A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with Arginine 89 to AlaninePromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_L91A-PolyA
Plasmid#112292PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) L91A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with Leucine 91 to AlaninePromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_F95A-PolyA
Plasmid#112293PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) F95A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with Phenylalanine 95 to AlaninePromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
SHIP2-ΔPS
Plasmid#214901Purposeexpression of the truncated variants of the SHIP2 without phosphatase domainDepositorInserthuman SHIP2 delta aa 419-739 (INPPL1 Human)
TagsV5/HisExpressionMammalianMutationdelta 419-739aaPromoterCMVAvailable sinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG_FBXL7 (R310H)
Plasmid#171849PurposepcDNA3-FLAG_FBXL7 (R310H)DepositorInsertF-box and leucine rich repeat protein 7 (FBXL7 Human)
TagsFlagExpressionMammalianMutationchanged Arginine 310 to HistidineAvailable sinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
SHIP2-ΔPR1
Plasmid#214902Purposeexpression of the truncated variants of the SHIP2 without first proline-rich domainDepositorInserthuman SHIP2 delta aa 123-410 (INPPL1 Human)
TagsV5/HisExpressionMammalianMutationdelta 123-410aaPromoterCMVAvailable sinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHIP2-C2
Plasmid#214906Purposeexpression of the truncated variants of the SHIP2 that retains second proline-rich domainDepositorInserthuman SHIP2 aa 740-1189 (INPPL1 Human)
TagsV5/HisExpressionMammalianMutationdelta 1-739, 1190-1258aaPromoterCMVAvailable sinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHIP2-N2
Plasmid#214904Purposeexpression of the truncated variants of the SHIP2 that retains first proline-rich domainDepositorInserthuman SHIP2 aa 123-418 (INPPL1 Human)
TagsV5/HisExpressionMammalianMutationdelta 1-122, 419-1258aaPromoterCMVAvailable sinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only