We narrowed to 7,122 results for: GFP expression plasmids
-
Plasmid#245377PurposeCre-dependent expression of FLAG-tagged Rpl22l1 and EGFP.DepositorAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pEN-L1-PJ23119-PplpT-sfGFP-TrrfB-BsaI-Scaf-L2
Plasmid#196250PurposePlasmid for cloning of a CRISPR-Cas9 guide RNA gene under promoter PJ23119DepositorInsertattL1-GlpT-scGFP-attL2
ExpressionBacterialPromoterJ23119 promoterAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
LZF1735 pAAV_hSyn-DiO-somArchon1-EGFP-P2A-somCheRiff
Plasmid#126512PurposeOptopatch4. Simultaneous optical recording and manipulation of electrical activity in neuronsDepositorInsertsomArchon1-EGFP-P2A-somCheRiff
UseAAVExpressionMammalianAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LZF1826 pAAV_hSyn-DiO-SomArchon-EGFP-P2A-stGtACR2
Plasmid#135412Purposesimultaneous optical recording and manipulation of electrical activity in neuronsDepositorInsertSomArchon-EGFP-P2A-stGtACR2
UseAAVExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Flex-PAK1-AID-ires-EGFP
Plasmid#83489Purposecre-dependent PAK1-AID under EF1a promoterDepositorInsertPAK1-AID-ires-EGFP
UseAAV and Cre/LoxExpressionMammalianAvailable SinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-GFP-pA
Plasmid#192500PurposeTo express DjCas13d compatible gRNA and GFPDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GFP-Fishell-1
Plasmid#83900PurposeGFP expression in forebrain GABA-ergic interneurons under the control of the mDlx enhancer elementDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InserteGFP
UseAAVPromotermDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
VI_pAAV-ProA7-GFP-WPRE
Plasmid#125891PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGFP
UseAAVPromoterProA7Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
VII_pAAV-ProB8-GFP-WPRE
Plasmid#125928PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGFP
UseAAVPromoterProB8Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMV0067 [15ARE23bp -p(cFos)-fLuc-UBC-rLuc-P2A-GFP]
Plasmid#246421PurposeFirefly luciferase driven by an AHR responsive minimal cFOS promoter and a renilla luciferase and GFP driven by a constitutive UBC promoter flipped with respect to the lentiviral backboneDepositorInsertsFirefly luciferase
Renilla luciferase-P2A-EGFP
UseLentiviralExpressionMammalianPromoterAHR responsive minimal cFOS promoter and UbCAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHL047 [15ARE23bp -p(TATA)-fLuc-UBC-rLuc-P2A-GFP]
Plasmid#246422PurposeFirefly luciferase driven by an AHR responsive minimal promoter and a renilla luciferase and GFP driven by a constitutive UBC promoter flipped with respect to the lentiviral backboneDepositorInsertsFirefly luciferase
Renilla luciferase-P2A-EGFP
UseLentiviralExpressionMammalianPromoterAHR responsive minimal promoter and UbCAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR0-37a +SV40 base prom-GFP-IRES-AP
Plasmid#225889PurposeEnhancer reporterDepositorInsertmR0-37a
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR3-17c +SV40 base prom-GFP-IRES-AP
Plasmid#225890PurposeEnhancer reporterDepositorInsertmR3-17c
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR3-17d +SV40 base prom-GFP-IRES-AP
Plasmid#225891PurposeEnhancer reporterDepositorInsertmR3-17d
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-Rab18-sfGFP(N) HDR template
Plasmid#129415PurposeHDR tempalte for tagging of endogenous human RAB18 N-terminus with sfGFPDepositorInsertRAB18 HDR template (RAB18 Human)
UseCRISPR and TALEN; Endogenous tagging hdr templateTagssfGFPExpressionMammalianAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP-SFPQ-IRES-mCherry
Plasmid#166950PurposeLentiviral plasmid expressing GFP-tagged SFPQ protein with IRES-mCherry from the EF1a promoterDepositorAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP-SFPQY527A-IRES-mCherry
Plasmid#166951PurposeLentiviral plasmid expressing GFP-tagged SFPQ Y527A protein with IRES-mCherry from the EF1a promoterDepositorInsertSFPQ-Y527A (SFPQ Human)
UseLentiviralTagsGFP and mCherryMutationSFPQ-Y527APromotereF1aAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-EZH2-PGK-Puro-IRES-GFP
Plasmid#75125PurposeRetroviral expression plasmid encoding wild type human EZH2DepositorAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only