We narrowed to 158 results for: H3.1
-
-
pCL1046
Plasmid#252436PurposeMitochondria-tethered construct for the RAPID-Release approachDepositorInsertHistone H3.2
TagsmCherry-TVMVx2-FRB-OMP25ExpressionMammalianPromoterCMVAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T_mouseH3.1-HaloTag
Plasmid#244242PurposeCRISPR/Cas9 donor plasmid to tag mouse histone H3.1 with Halo tagDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-K36M TAIL[1-44]-3AID-HA-2A-mCherryBSD
Plasmid#225872PurposeLentiviral expression of AID degron tagged H3.3(K36M) histone tail corresponding to amino acids 1-44 and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationamino acids 1-44 from H3.3 K36MAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Suv39H1_1
Plasmid#36342DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
H3S10ph biosensor
Plasmid#120809PurposeFRET biosensor. To monitor histone H3 Serine 10 phosphorylation in mammalian cells by FRETDepositorInsertMouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa)-YFP
ExpressionMammalianMutationThreonine 3, Threonine 6, and Threonine 11 are mu…PromoterCMVAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
SUV[SET]-dCas9
Plasmid#100088PurposeCatalytic domain [SET] of human SUVAR39H1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertSUVAR39H1 (SUV39H1 Human)
UseCRISPRTags3XFLag-NLS-SUV[SET]-dCas9-NLSExpressionMammalianMutationdeleted aa 1-76PromoterCMVAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pET3a-Xl-H3∆Nterm[R42]
Plasmid#221201PurposeXenopus laevis histone H3 with N-terminal tail deleted.DepositorInsertXl-H3∆Nterm[R42]
ExpressionBacterialAvailable SinceJuly 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET3_H3.1_C96S_C110A_K79C
Plasmid#252955PurposeExpression of human histone 3.1 mutant for generating lysine analogue H3.1_K79me2/3DepositorInsertH3.1_C96S_C110A_K79C
ExpressionBacterialMutationC96S_C110A_K79CPromoterT7Available SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
S10A mutant of H3S10ph biosensor
Plasmid#120810PurposeFRET biosensor. Eliminating the H3 Serine 10 phosphorylation site in H3S10ph biosensor to abolish the detection capabilityDepositorInsertMouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa) S10A-YFP
ExpressionMammalianMutationSerine 10 is mutated to Alanine, and Threonine 3,…PromoterCMVAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SETDB1_WT
Plasmid#82291PurposeGateway Donor vector containing SETDB1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_mouseH3.1
Plasmid#244241PurposeExpresses SpCas9 and a sgRNA targeting the mouse histone H3.1 loci for knock-in.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
SKA1 H3.1 gRNA
Plasmid#90888Purpose3rd generation lentiviral gRNA plasmid targeting human SKA1DepositorInsertSKA1 (Guide Designation H3.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
px459-H3.3 (H3f3b) sgRNA
Plasmid#186931PurposeH3f3b sgRNA used for genomic targeting at H3f3b C-terminalDepositorAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXJ-His-CD276
Plasmid#232662Purposetransient expresses CD276 in mammalian cellsDepositorAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBlueScript II SK-SNAP donor for H3f3b
Plasmid#186933PurposeGenomic targeting of SNAP tag at H3f3b C-terminalDepositorAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA Display H3_A/Hong Kong/1/1968
Plasmid#206506PurposeExpresses H3_Hong Kong/1/1968 in the surface of mammalian cellsDepositorInsertH3_A/Hong Kong/1/1968
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationdeleted amino acids 1651 to 1735PromoterCMVAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
px459-H3f3a KO sgRNA
Plasmid#186940PurposeH3f3a KO in mouse ES cellsDepositorAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only