We narrowed to 162 results for: H3.1
-
Plasmid#258598PurposeExpression of NrdJ-1 C intein fused with histone H3.1(10-130) in bacteriaDepositorInsertNrdJ-1C-H3.1(10-130)
ExpressionBacterialMutationincludes only aa 10-130 of H3.1Available sinceAug. 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pc2099-pEGFP-H3.1
Plasmid#241429PurposeExpresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1DepositorAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCL1161
Plasmid#217964PurposeFor RAPID-release of H3-APEX-eGFP in the Flp-in T-Rex system (ThermoFisher).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHistone H3.1 (H3C1 Human)
TagseGFP, APEXExpressionMammalianPromoterCMVAvailable sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pCL1046
Plasmid#252436PurposeMitochondria-tethered construct for the RAPID-Release approachDepositorInsertHistone H3.2
TagsmCherry-TVMVx2-FRB-OMP25ExpressionMammalianPromoterCMVAvailable sinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T_mouseH3.1-HaloTag
Plasmid#244242PurposeCRISPR/Cas9 donor plasmid to tag mouse histone H3.1 with Halo tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertH3.1 (H3c1 Mouse)
UseCRISPRTagsHaloTagAvailable sinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Suv39H1_1
Plasmid#36342DepositorAvailable sinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-K36M TAIL[1-44]-3AID-HA-2A-mCherryBSD
Plasmid#225872PurposeLentiviral expression of AID degron tagged H3.3(K36M) histone tail corresponding to amino acids 1-44 and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationamino acids 1-44 from H3.3 K36MAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
H3S10ph biosensor
Plasmid#120809PurposeFRET biosensor. To monitor histone H3 Serine 10 phosphorylation in mammalian cells by FRETDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa)-YFP
ExpressionMammalianMutationThreonine 3, Threonine 6, and Threonine 11 are mu…PromoterCMVAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
SUV[SET]-dCas9
Plasmid#100088PurposeCatalytic domain [SET] of human SUVAR39H1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSUVAR39H1 (SUV39H1 Human)
UseCRISPRTags3XFLag-NLS-SUV[SET]-dCas9-NLSExpressionMammalianMutationdeleted aa 1-76PromoterCMVAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pET3a-Xl-H3∆Nterm[R42]
Plasmid#221201PurposeXenopus laevis histone H3 with N-terminal tail deleted.DepositorInsertXl-H3∆Nterm[R42]
ExpressionBacterialAvailable sinceJuly 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET3_H3.1_C96S_C110A_K79C
Plasmid#252955PurposeExpression of human histone 3.1 mutant for generating lysine analogue H3.1_K79me2/3DepositorInsertH3.1_C96S_C110A_K79C
ExpressionBacterialMutationC96S_C110A_K79CPromoterT7Available sinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
S10A mutant of H3S10ph biosensor
Plasmid#120810PurposeFRET biosensor. Eliminating the H3 Serine 10 phosphorylation site in H3S10ph biosensor to abolish the detection capabilityDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa) S10A-YFP
ExpressionMammalianMutationSerine 10 is mutated to Alanine, and Threonine 3,…PromoterCMVAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SETDB1_WT
Plasmid#82291PurposeGateway Donor vector containing SETDB1, part of the Target Accelerator Plasmid Collection.DepositorAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330_mouseH3.1
Plasmid#244241PurposeExpresses SpCas9 and a sgRNA targeting the mouse histone H3.1 loci for knock-in.DepositorAvailable sinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
SKA1 H3.1 gRNA
Plasmid#90888Purpose3rd generation lentiviral gRNA plasmid targeting human SKA1DepositorInsertSKA1 (Guide Designation H3.1)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXJ-His-CD276
Plasmid#232662Purposetransient expresses CD276 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCD276 (CD276 Human)
TagsHisExpressionMammalianPromoterCMVAvailable sinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
px459-H3.3 (H3f3b) sgRNA
Plasmid#186931PurposeH3f3b sgRNA used for genomic targeting at H3f3b C-terminalDepositorPublicationAvailable sinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only