We narrowed to 18,932 results for: gateway
-
Plasmid#70408PurposeGateway ORF clone of human MAP2K2 [NM_030662.3] without stop codon (for C-terminal fusions)DepositorInsertMAP2K2 (MAP2K2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E081 Hs.EXOC8
Plasmid#70365PurposeGateway ORF clone of human EXOC8 [NM_175876.4] with stop codon (for native or N-terminal fusions)DepositorInsertEXOC8 (EXOC8 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E144 Hs.NFKB1-nostop
Plasmid#70428PurposeGateway ORF clone of human NFKB1 [NM_003998.3] without stop codon (for C-terminal fusions)DepositorInsertNFKB1 (NFKB1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E003 Hs.AKT2
Plasmid#70287PurposeGateway ORF clone of human AKT2 [NM_001626.5] with stop codon (for native or N-terminal fusions)DepositorInsertAKT 2 (AKT2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E088 Hs.FGFR3-nostop
Plasmid#70372PurposeGateway ORF clone of human FGFR3 [NM_000142.4] without stop codon (for C-terminal fusions)DepositorInsertFGFR3 (FGFR3 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E077 Hs.EXOC6
Plasmid#70361PurposeGateway ORF clone of human EXOC6 [NM_019053.4] with stop codon (for native or N-terminal fusions)DepositorInsertEXOC6 (EXOC6 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E316 Hs.SHOC2-nostop
Plasmid#70600PurposeGateway ORF clone of human SHOC2 [NM_007373.3] without stop codon (for C-terminal fusions)DepositorInsertSHOC2 (SHOC2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E178 Hs.PIK3R4-nostop
Plasmid#70462PurposeGateway ORF clone of human PIK3R4 [NM_014602.2] without stop codon (for C-terminal fusions)DepositorInsertPIK3R4 (PIK3R4 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E234 Hs.RASAL1-nostop
Plasmid#70518PurposeGateway ORF clone of human RASAL1 [NM_001193521.1] without stop codon (for C-terminal fusions)DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E031 Hs.CYTH2
Plasmid#70315PurposeGateway ORF clone of human CYTH2 [NM_017457.5] with stop codon (for native or N-terminal fusions)DepositorInsertCYTH2 (CYTH2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E030 Hs.CNKSR2-nostop
Plasmid#70314PurposeGateway ORF clone of human CNKSR2 [NM_001168647.1] without stop codon (for C-terminal fusions)DepositorInsertCNKSR2 (CNKSR2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E201 Hs.PRKAG2
Plasmid#70485PurposeGateway ORF clone of human PRKAG2 [NM_024429.1] with stop codon (for native or N-terminal fusions)DepositorInsertPRKAG2 (PRKAG2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E074 Hs.EXOC4-nostop
Plasmid#70358PurposeGateway ORF clone of human EXOC4 [NM_021807.3] without stop codon (for C-terminal fusions)DepositorInsertEXOC4 (EXOC4 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E068 Hs.EXOC1-nostop
Plasmid#70352PurposeGateway ORF clone of human EXOC1 [NM_001024924.1] without stop codon (for C-terminal fusions)DepositorInsertEXOC1 (EXOC1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E072 Hs.EXOC3-nostop
Plasmid#70356PurposeGateway ORF clone of human EXOC3 [NM_007277.4] without stop codon (for C-terminal fusions)DepositorInsertEXOC3 (EXOC3 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E156 Hs.PDGFRA-nostop
Plasmid#70440PurposeGateway ORF clone of human PDGFRA [NM_006206.4] without stop codon (for C-terminal fusions)DepositorInsertPDGFRA (PDGFRA Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E142 Hs.NFE2L2-nostop
Plasmid#70426PurposeGateway ORF clone of human NFE2L2 [NM_006164.4] without stop codon (for C-terminal fusions)DepositorInsertNFE2L2 (NFE2L2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E056 Hs.EIF4EBP1-nostop
Plasmid#70340PurposeGateway ORF clone of human EIF4EBP1 [NM_004095.3] without stop codon (for C-terminal fusions)DepositorInsertEIF4EBP1 (EIF4EBP1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E147 Hs.PAK1
Plasmid#70431PurposeGateway ORF clone of human PAK1 [NM_002576.4] with stop codon (for native or N-terminal fusions)DepositorInsertPAK1 (PAK1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E092 Hs.FLT3-nostop
Plasmid#70376PurposeGateway ORF clone of human FLT3 [NM_004119.2] without stop codon (for C-terminal fusions)DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E155 Hs.PDGFRA
Plasmid#70439PurposeGateway ORF clone of human PDGFRA [NM_006206.4] with stop codon (for native or N-terminal fusions)DepositorInsertPDGFRA (PDGFRA Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
9336-E07
Plasmid#234302PurposeGateway ORF Entry clone of human TGFBR1 NDN to A with stop codon (for native or N-terminal fusions)DepositorAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
8522-E08
Plasmid#234293PurposeGateway ORF Entry clone of mouse Tgfbr1 with stop codon (for native or N-terminal fusions); N/267A/D269A/N270A mutationsDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
9336-E05
Plasmid#234300PurposeGateway ORF Entry clone of human Tgfbr1 with stop codon (for native or N-terminal fusions); T204D mutationDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
9336-E06
Plasmid#234301PurposeGateway ORF Entry clone of human TGFBR1 with stop codon (for native or N-terminal fusions); K232R mutationDepositorAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pDONR221-hspa13
Plasmid#192730PurposeGateway entry vector encoding zebrafish hspa13DepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-dyrk1aa
Plasmid#192741PurposeGateway entry vector encoding zebrafish dyrk1aaDepositorAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway CloningMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ets2
Plasmid#192724PurposeGateway entry vector encoding zebrafish ets2DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
R777-E300 Hs.RPS6KB2-nostop
Plasmid#70584PurposeGateway ORF clone of human RPS6KB2 [NM_003952.2] without stop codon (for C-terminal fusions)DepositorInsertRPS6KB2 (RPS6KB2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E208 Hs.RAC1-nostop
Plasmid#70492PurposeGateway ORF clone of human RAC1 [NM_006908.4] without stop codon (for C-terminal fusions)DepositorInsertRAC1 (RAC1 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E194 Hs.PRKAA2-nostop
Plasmid#70478PurposeGateway ORF clone of human PRKAA2 [NM_006252.3] without stop codon (for C-terminal fusions)DepositorInsertPRKAA2 (PRKAA2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E082 Hs.EXOC8-nostop
Plasmid#70366PurposeGateway ORF clone of human EXOC8 [NM_175876.4] without stop codon (for C-terminal fusions)DepositorInsertEXOC8 (EXOC8 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E060 Hs.EIF4EBP3-nostop
Plasmid#70344PurposeGateway ORF clone of human EIF4EBP3 [NM_003732.2] without stop codon (for C-terminal fusions)DepositorInsertEIF4EBP3 (EIF4EBP3 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
R777-E032 Hs.CYTH2-nostop
Plasmid#70316PurposeGateway ORF clone of human CYTH2 [NM_017457.5] without stop codon (for C-terminal fusions)DepositorInsertCYTH2 (CYTH2 Human)
UseGateway CloningAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB103
Plasmid#68557PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB104
Plasmid#68558PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsGUSExpressionPlantAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLVU/RED
Plasmid#24178DepositorInsertChloramphenicol resistance gene (CmR) - ccdB gene
UseGateway Cloning and LentiviralTagsDsREDExpressionMammalianAvailable SinceSept. 23, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB313
Plasmid#68641PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsGlucocorticoid receptor (GR)ExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB303
Plasmid#68631PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneExpressionPlantPromoterMpEF1alpha promoterAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only