We narrowed to 35,392 results for: CaS;
-
Plasmid#173903PurposeSB-transposon with inducible expression of SpCas9 PE2DepositorInsertPE2
UseCRISPRTagsSV40 NLSExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgSnrk
Plasmid#177236PurposeExpresses neomycin (bU6), non-targeting (mU6) and Snrk (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgSnrk
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNuak1-hU6-sgNuak2
Plasmid#177234PurposeExpresses Neomycin (bU6), Nuak1 (mU6) and Nuak2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNuak1/sgNuak2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgAmpk1-hU6-sgAmpk2
Plasmid#177233PurposeExpresses Neomycin (bU6), Ampk1 (mU6) and Ampk2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgPrkaa1/sgPrkaa2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgLkb1_2nd
Plasmid#177230PurposeExpresses Neomycin(bU6), non-targeting (mU6) and Lkb1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgLkb1_2nd
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgLkb1_1st
Plasmid#177227PurposeExpresses Neomycin(bU6), non-targeting (mU6) and Lkb1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgLkb1_1st
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZBTB5-donor
Plasmid#112303PurposeCRISPR donor plasmid to tag human transcription factor ZBTB5 with GFPDepositorInsertZBTB5 homology arms flanking EGFP-IRES-Neo cassette (ZBTB5 Human)
UseCRISPRAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDD316
Plasmid#137020PurposemTurq2-GLO^SEC^2xHA vector with ccdB markers for cloning homology armsDepositorInsertmTurq2-GLO^SEC^2xHA + ccdB
UseCRISPR and Cre/LoxTags2xHA and C. elegans GLO-optimized mTurq2ExpressionWormAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAMTA2-donor
Plasmid#132501PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceMarch 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFP-hPMCA4bct125
Plasmid#47594DepositorInsertPMCA4bct125 (ATP2B4 Human)
TagsEGFPExpressionMammalianMutation125 C terminal AA deletedPromoterCMVAvailable SinceAug. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-ZNF865-UbC-DsRed-P2A-Bsr
Plasmid#241309PurposeLentiviral SpCas9-gRNA (ZNF865) expression vector with DsRed-Express2-P2A-BlastRDepositorInsertZNF865 gRNA (ZNF865 Human)
UseLentiviralAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ12-PB-U6-ND1-acti-gRNA1
Plasmid#131056PurposeActivation of NeuroD1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ13-PB-U6-ND1-acti-gRNA2
Plasmid#131057PurposeActivation of NeuroD1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ14-PB-U6-ND1-acti-gRNA3
Plasmid#131058PurposeActivation of NeuroD1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_031
Plasmid#245331PurposeCas12a CRISPRko all-in-one positive control; targets CD47, CD63DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_245
Plasmid#245332PurposeCas12a CRISPRko positive control guide; targets CD46DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_837
Plasmid#245328PurposeCas9 CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_247
Plasmid#245334PurposeCas12a CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA097
Plasmid#245319PurposeCas12a CRISPRko positive control; targets CD46, CD47, CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
AgU6.695&MosU6.syn_3xP3-DsRed1-SV40 (Tandem 2_2 gRNAs)
Plasmid#243013PurposeFor cloning two gRNAs in tandem after BspQI digestion under An. gambiae U6.695 and U6.MosU6syn (synthetic mosquito U6) promoters.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionInsectAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-scr
Plasmid#229847PurposeExpresses wild-type Cas9 and scrambled gRNA.DepositorInsertguide RNA with scrambled sequence
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOliSpec5'
Plasmid#228551PurposeTemplate for PCR amplification for gRNA cloning. The PCR product recombines in vivo with a PCRs products from pOliSpec3' and oligo-spacer amplifications, to clone gRNA plasmidDepositorInsertTruncated 5' region of aadA
UseCRISPRAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOliSpec3'
Plasmid#228550PurposeTemplate for PCR amplification for gRNA cloning. The PCR product recombines in vivo with a PCRs products from pOliSpec5' and oligo-spacer amplifications, to clone gRNA plasmid.DepositorInsertTruncated 3' region of aadA
UseCRISPRAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpec5'
Plasmid#228549PurposeTemplate for PCR amplification for gRNA cloning plasmid. The PCR product recombines in vivo with a PCR product from pSpec3', to clone gRNA plasmidDepositorInsertTruncated 5' region of aadA
UseCRISPRAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpec3'
Plasmid#228548PurposeTemplate for PCR amplification for gRNA cloning plasmid. The PCR product recombines in vivo with a PCR product from pSpec5', to clone gRNA plasmidDepositorInsertTruncated 3' region of aadA
UseCRISPRAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXR004_puroR
Plasmid#219820PurposehU6-driven pre-gRNA plasmid for CasRx applications with puromycin resistance. 5' processed DR followed by BbsI sites for guide cloning (Adapted from plasmid #10954)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterhU6Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJ1-g1g2-K2
Plasmid#218217PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAs, MoClo compatibleDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK7-g7g8-K8
Plasmid#218220PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK3-g3g4-K4
Plasmid#218218PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK5-g5g6-K6
Plasmid#218219PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-CD4
Plasmid#188691PurposesgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PHGDH-int2
Plasmid#188682Purposecontrol sgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PHGDH-int1
Plasmid#188681Purposecontrol sgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only