We narrowed to 7,396 results for: Tet-on
-
Plasmid#78202PurposeExpression of double-cysteine variant of plasmid segregation protein, ParM, as scaffold for ADP biosensorDepositorInsertparM (K33A D63C T174A T175N D224C C287A)
TagsHis6ExpressionBacterialMutationK33A D63C T174A T175N D224C C287APromoterunknownAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLAG-3C-sGFP1-10_pcDNA3.1(-)
Plasmid#182931PurposeFor expression of membrane protein with N-terminal FLAG tag and C-terminal split GFP1-10 fragmentDepositorTypeEmpty backboneTags3C-cleavable split GFP 1-10, FLAG tag, and HA sig…ExpressionMammalianPromoterCMVAvailable SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pComb3HTT
Plasmid#63900PurposeBackbone of pComb3H containing TT Fab (light and heavy chains) against tetanus toxin, used as phage display/expression control.DepositorInsertTT Fab
UsePhage displayTagsgeneIIIExpressionBacterialPromoterlacZAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRE4 CTFdeltaTA-FLAG
Plasmid#217725PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRE4
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-179Available SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-F0ATPMLS-mCherry-GFP1-10
Plasmid#211466PurposeLentivirus backbone expressing mCherry and GFP1-10 fusion protein with a mitochondrial localization signalDepositorInsertmito-mCherry-GFP1-10
UseLentiviralExpressionMammalianPromoterEF-1aAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA221TadA*-T7RNAP
Plasmid#167980PurposeExpresses fusion protein TadA*-T7RNAP in E. coliDepositorInsertTadA*-T7RNAP
TagsT7 tag and T7RNAPExpressionBacterialPromoterTetR-PtetAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-Ec.coaD (pESC106)
Plasmid#50388PurposeHeterologous expression of E. coli CoA biosynthetic enzyme, PPAT (phosphopantetheine adenylyltransferase). Contain 6xHis-tag for nickel affinity purification.DepositorInsertPPAT
Tags6xHis-tagExpressionBacterialPromoterT7Available SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFU-AgaIVA-VG
Plasmid#24145DepositorInsertVenus-AgatoxinIVA-FLAG-GPI anchor
UseLentiviralExpressionMammalianAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pALS3-Ma-sfGFP-TAG150
Plasmid#212121PurposeFluorescence plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-TAG150 and M. alvus Pyl-tRNA(6). p15a origin. Tetracycline resistance.DepositorInsertssfGFP-150TAG
M. alvus Pyl-tRNA(6)
TagsHis6ExpressionBacterialMutationN150TAGPromoteraraC and lppAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSECRETS-A
Plasmid#196986PurposeFor SECRETS protocol to screen for gRNA activity and specificity: bacterial expression Cas9 in the presence of anhydrotetracycline (aTc).DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterpltetO1Available SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBL4
Plasmid#50548PurposeExpresses CcaS and CcaR constitutively, and sfGFP/TetR under the PcpcG2 promoterDepositorInsertsCcaS
CcaR
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
Marathon-RT for Split-PE (pEH59)
Plasmid#190108PurposeExpresses Marathon-RT (human codon optimization)DepositorInsertMarathon-RT
TagsbpNLSExpressionMammalianPromoterCMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRosa26 R1-ccdB-R2 RexNeo PI-SceI
Plasmid#24418DepositorInsert
UseMouse TargetingAvailable SinceMarch 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJBL701
Plasmid#140371PurposeExpresses TetR protein under the control of T7-lacO promoterDepositorInsertT7-lacO-TetR-T
Tags6XHisExpressionBacterialAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCL66-decoder
Plasmid#159453PurposeInsert: Pfus1mut-tetR-nls-malE-tCyc1. Same insert as pCL33-decoder in a multiple integration shuttle vector. Backbone: pRG235 (addgene). Marker: Leu2.DepositorInsertPfus1mut-tetR-nls-malE-tCyc1
UseSynthetic BiologyExpressionYeastPromoterPfus1mutAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEVA221AID-T7RNAP
Plasmid#167977PurposeExpresses fusion protein AID-T7RNAP in E. coliDepositorInsertAID-T7RNAP
TagsT7 tag and T7RNAPExpressionBacterialPromoterTetR-PtetAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDB007ns2a
Plasmid#99214PurposeAccessory plasmid for PACE of PylRS variants; negative selectionDepositorInsertPpsp [SD8] gIII; PproK tyrT(Opt,CUA); Ptet [SD4] T7RNAP(S12*,S203*)
Mutationamber codons at positions 12 and 203 of T7 RNA po…PromoterPpsp, PproK, and PtetAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUHD-AID
Plasmid#121066Purposevector expresses AID-fusion protein under TRE promoter and with puromycin resistance selectionDepositorTypeEmpty backboneTagsAIDExpressionMammalianPromoterTREAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only