We narrowed to 10,605 results for: yeast
-
Plasmid#252967PurposeEncodes S. cerevisiae MYC Tag-Aga2-linker as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD055
Plasmid#252968PurposeEncodes S. cerevisiae Aga2-(NoTag)-linker as a Type 3a part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD053
Plasmid#252966PurposeEncodes S. cerevisiae 2xFLAG-Tag-Aga2-linker as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD095
Plasmid#252985PurposeEncodes GFP11-M3 as a Type 4a part to be used for fluoresence complementation based detection in the yeast secretion/display (YSD2.0) MoClo toolkit Fluoresence ComplementationDepositorInsertGFP11-M3
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD052
Plasmid#252965PurposeEncodes S. cerevisiae HA Tag-Aga2-linker as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD058
Plasmid#252971PurposeEncodes S. cerevisiae MYC Tag-Aga2-linker as a Type 3a part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD051
Plasmid#252964PurposeEncodes S. cerevisiae Aga2-(NoTag)-linker as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GBKT7
Plasmid#248655PurposeEmpty vector for generating yeast 2-hybrid GAL4 DNA binding domain fusion constructs by Gateway cloning. It may also be used as an empty vector experimental control.DepositorTypeEmpty backboneUseYeast 2-hybridTagsGAL4 binding domain, MycExpressionYeastAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GADT7
Plasmid#248657PurposeEmpty vector for generating yeast 2-hybrid GAL4 activation domain fusion constructs by Gateway cloning. It may also be used as an empty vector experimental control.DepositorTypeEmpty backboneUseYeast 2-hybridTagsGAL4 activation domain, HAExpressionYeastAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWN103
Plasmid#233860PurposeMoClo-YTK; ConLS/R1 cassette; NS3 systems; pTDH3-LexA-NES-NS3-V1-NLS-VP48-2XOaf1-tADH1DepositorInsertpTDH3-LexA-NES-NS3-V1-NLS-VP48-2XOaf1-tADH1
ExpressionYeastAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWN104
Plasmid#233861PurposeMoClo-YTK; ConLS/R1 cassette; NS3 systems; pTDH3-LexA-NES-NS3-V2-NLS-VP48-2XOaf1-tADH1DepositorInsertpTDH3-LexA-NES-NS3-V2-NLS-VP48-2XOaf1-tADH1
ExpressionYeastAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAL007
Plasmid#233866PurposeMoClo-YTK URA multigene plasmid with MCS; NS3 systems; pTDH3-LexA-NLS-NS3-V1-VP48-2xOaf1-tADH1; lexAO6-pLEU2m-MCS-tENO2DepositorInsertpTDH3-LexA-NLS-NS3-V1-VP48-2xOaf1-tADH1; lexAO6-pLEU2m-MCS-tENO2
ExpressionYeastAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYI277
Plasmid#228285PurposeConstitutive EGFP expressionDepositorInsertEGFP
UseSynthetic BiologyExpressionYeastPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only