We narrowed to 24,466 results for: c-myc
-
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJT309 RapInducible1-ActivatorCloneSite-Citrine
Plasmid#187321PurposeRapamycin inducible genetic circuit with cloning site for activator domainsDepositorTypeEmpty backboneExpressionMammalianAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMECP2-GFP
Plasmid#181904PurposeFluorescently tagged MECP2, GFPDepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPHR-mCherry-hNCL
Plasmid#181886PurposeSoluble light-dependent effector protein (nucleolin) for optodroplet formation or recruitment to CIBN localizersDepositorInsertPHR-mCherry-hNCL (NCL Mustard Weed, Human)
TagsPHR-mCherryExpressionMammalianPromoterCMVAvailable SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP249 pGK-dCas9-DNMT3a V3
Plasmid#100938PurposedCas9 and DNMT WT driven by pGK promoter and Puromycin driven by EF1aDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A S.pyogenes, Human)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGGG L2 TaStb15
Plasmid#226630PurposeWheat transformation vector used to express wheat Septoria tritici blotch (Stb) resistance gene 15DepositorInsertTriticum aestivum (wheat) Septoria tritici blotch 15 (TaStb15) disease resistance gene
UseSynthetic BiologyExpressionPlantPromoterNative TaStb15Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMECP2-RFP
Plasmid#181905PurposeFluorescently tagged MECP2, RFPDepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28 His6-mEGFP-D4H
Plasmid#226373PurposeProduction of recombinant mEGFP-D4H, a fluorescent probe binding cholesterolDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME GFP-PCNA
Plasmid#105977Purposeentry clone for gateway cloning, cell cycle marker proliferative cell nuclear antigen PCNADepositorAvailable SinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
EC71171
Plasmid#154069PurposeLevel 0 Golden Gate vector, CRE with U5 intron at 254bp, in pICH41308 backboneDepositorInsertCRE_U5intron
UseSynthetic BiologyMutationAll BsaI, Esp3I and BPiI restriction sites were r…Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
EC71139
Plasmid#154062PurposeLevel 0 Golden Gate vector, containing the ZmUbi promoter and 5' UTR with Level 0.5-compatible overhangs (Barley Construct)DepositorInsertpZmUbi
UseSynthetic BiologyMutationAll BsaI, Esp3I and BpiI restriction sites were r…Available SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) NAPstar3b
Plasmid#232736PurposeExpresses NADPH/NADP+ biosensor NAPstar3b in mammalian cells.DepositorInsertNAPstar3b
ExpressionMammalianAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas-dCas12m
Plasmid#192275PurposeEncodes MmdCas12m (D485A) under a constitutive promoterDepositorInsertMmdCas12m
UseCRISPRExpressionBacterialMutationD485APromoterPJ23108Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pF CAG luc hygro
Plasmid#67502PurposeConstitutive expression of firefly luciferase in mammalian cellsDepositorInsertFirefly luciferase
UseLentiviral and LuciferaseExpressionMammalianPromoterCAGAvailable SinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits only