We narrowed to 6,178 results for: cas9 expression plasmid

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87400

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87385

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#159741

Expresses Cas9-2A-Blast and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.

Stefan Kubicek

Reicher et al Genome Res. 2020 Dec;30(12):1846-1855. d

Nov. 18, 2020

Academic Institutions and Nonprofits only

#159742

Expresses Cas9-2A-mCherry and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.

Stefan Kubicek

Reicher et al Genome Res. 2020 Dec;30(12):1846-1855. d

Nov. 18, 2020

Academic Institutions and Nonprofits only

#73437

CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant G6.

Mattheos Koffas

Cress et al Nucleic Acids Res. 2016 Apr 13. pii: gkw

March 3, 2016

Academic Institutions and Nonprofits only

#73427

CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4.

Mattheos Koffas

Cress et al Nucleic Acids Res. 2016 Apr 13. pii: gkw

April 4, 2016

Academic Institutions and Nonprofits only

#186669

Plasmid containing Cas9 and ANKRD1 sgRNA2 , sgRNA sequence: cggtcagcttatatagct.

Astrid Haase

Meng et al Nucleic Acids Res. 2022 May 27. pii: 659

July 26, 2022

Academic Institutions and Nonprofits only

#249542

Cre-dependent editing of rat Htr2a with SaCas9

Larry Zweifel

Dec. 17, 2025

Academic Institutions and Nonprofits only

#192664

3rd generation lenti vector encoding dCas9-KRAB-MeCP2 with 2A Hygro resistance marker

Jeffrey Miner

Dec. 14, 2022

Academic Institutions and Nonprofits only