We narrowed to 882 results for: inha
-
Plasmid#225697PurposeLentiviral expression of AID degron tagged Wildtype H3.3 and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationPromoterAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-H3.3(K27M)-3AID-HA-2A-mCherryBSD
Plasmid#225698PurposeLentiviral expression of AID degron tagged H3.3(K27M) and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationK27MPromoterpEF1AAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1 double gRNAs
Plasmid#162791PurposeMultiplex Guide RNAs to generate Nr4a1 knockout by CRISPRDepositorInsertMultiplex Nr4a1 gRNA 1 and 2 (Nr4a1 Mouse)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-HA-Nr4a1-AA
Plasmid#160942PurposeGeneration of retrovirus for the overexpression of Nr4a1 mutant (287C 288EAA)DepositorInsertNr4a1 (Nr4a1 Mouse)
UseRetroviralTagsHA tagExpressionMammalianMutationChange Cys 287 Glu 288 into Ala AlaPromoterMSCV-LTRAvailable sinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-HA-Nr4a1-Zf2
Plasmid#160944PurposeGeneration of retrovirus for the overexpression of Nr4a1 mutant (zinc finger 2 deletion)DepositorInsertNr4a1 (Nr4a1 Mouse)
UseRetroviralTagsHA tagExpressionMammalianMutationDeletion of Zinc finger 2 (C306 to C330)PromoterMSCV-LTRAvailable sinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-HA-Nr4a1-Zf1
Plasmid#160943PurposeGeneration of retrovirus for the overexpression of Nr4a1 mutant (zinc finger 1 deletion)DepositorInsertNr4a1 (Nr4a1 Mouse)
UseRetroviralTagsHA tagExpressionMammalianMutationDeletion of Zinc finger 1 (C270 to C290)PromoterMSCV-LTRAvailable sinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorInsertAICD (APP Human)
UseAAVTagsExpressionMutationNonePromoterhuman synapsinAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-K36M TAIL[1-44]-3AID-HA-2A-mCherryBSD
Plasmid#225872PurposeLentiviral expression of AID degron tagged H3.3(K36M) histone tail corresponding to amino acids 1-44 and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationamino acids 1-44 from H3.3 K36MPromoterAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only